Transcript: Human NM_198175.1

Homo sapiens NME/NM23 nucleoside diphosphate kinase 1 (NME1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
NME1 (4830)
Length:
1031
CDS:
254..787

Additional Resources:

NCBI RefSeq record:
NM_198175.1
NBCI Gene record:
NME1 (4830)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147480 GGAGACTTCTGCATACAAGT pXPR_003 TGG 407 76% 5 0.4826 NME1, NME1-NME2 NME1-NME2 75886
2 BRDN0001162403 CATTGCGATCAAACCAGATG pXPR_003 GGG 115 22% 3 0.3734 NME1, NME1-NME2 NME1-NME2 75887
3 BRDN0001145211 TGAATTTCAGACCAACAAGG pXPR_003 CGG 179 34% 3 0.2942 NME1, NME1-NME2 NME1-NME2 75885
4 BRDN0001145504 AAGACGGGCCGAGTCATGCT pXPR_003 CGG 344 64% 5 0.2569 NME1, NME1-NME2 NME1 75537
5 BRDN0001146284 GTGCATGTATTTCACCAGGC pXPR_003 CGG 265 50% 4 0.1592 NME1, NME1-NME2 NME1 75539
6 BRDN0001146170 GGCTTCCGAAGATCTTCTCA pXPR_003 AGG 217 41% 4 0.1519 NME1, NME1-NME2 NME1 75538
7 BRDN0001162367 GACGGGCCGAGTCATGCTCG pXPR_003 GGG 346 65% 5 -0.2279 NME1, NME1-NME2 NME1-NME2 75888
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198175.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197006 GCTCAGAACTGGATCTATGAA pLKO.1 764 CDS 100% 5.625 4.500 N NME1 n/a
2 TRCN0000010064 TGGAGAGTGCAGAGAAGGAGA pLKO.1 696 CDS 100% 2.640 1.848 N NME1 n/a
3 TRCN0000199648 GCTTGTGGTTTCACCCTGAGG pLKO.1 720 CDS 100% 0.720 0.504 N NME1 n/a
4 TRCN0000194801 CTAGTTATTTACAGGAACTTC pLKO.1 864 3UTR 100% 0.000 0.000 N NME1 n/a
5 TRCN0000010062 CCGCCTTGTTGGTCTGAAATT pLKO.1 427 CDS 100% 13.200 6.600 Y NME1 n/a
6 TRCN0000010061 TCCGCCTTGTTGGTCTGAAAT pLKO.1 426 CDS 100% 13.200 6.600 Y NME1 n/a
7 TRCN0000234326 TCCGCCTTGTTGGTCTGAAAT pLKO_005 426 CDS 100% 13.200 6.600 Y NME1-NME2 n/a
8 TRCN0000381376 TGAAGGACCGTCCATTCTTTG pLKO_005 492 CDS 100% 10.800 5.400 Y NME1-NME2 n/a
9 TRCN0000010055 GCGTACCTTCATTGCGATCAA pLKO.1 343 CDS 100% 4.950 2.475 Y NME1 n/a
10 TRCN0000195555 CTCAAGGAACACTACGTTGAC pLKO.1 470 CDS 100% 4.050 2.025 Y NME1 n/a
11 TRCN0000010063 CGGCCTGGTGAAATACATGCA pLKO.1 514 CDS 100% 2.640 1.320 Y NME1 n/a
12 TRCN0000024732 GCCTGGTGAAATACATGCACT pLKO.1 516 CDS 100% 2.640 1.320 Y Nme1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198175.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01101 pDONR223 100% 85.8% 85.8% None 1_75del n/a
2 ccsbBroad304_01101 pLX_304 0% 85.8% 85.8% V5 1_75del n/a
3 TRCN0000468949 CACCGCTGGGTGCTAGCGAGCCCG pLX_317 73.3% 85.8% 85.8% V5 1_75del n/a
4 ccsbBroadEn_14714 pDONR223 0% 85.8% 85.8% None 1_75del n/a
5 ccsbBroad304_14714 pLX_304 0% 85.8% 85.8% V5 1_75del n/a
6 TRCN0000479668 TTTTAGCACTCTCCAGTATATATA pLX_317 69.3% 85.8% 85.8% V5 1_75del n/a
7 TRCN0000488282 CTTCCTTTCGAGACTCGATGACCG pLX_317 63.2% 85.8% 85.8% V5 (not translated due to prior stop codon) 1_75del n/a
8 TRCN0000489477 CTTACCCCATGCGATACCGACTGC pLX_317 56.7% 85.7% 85.3% V5 1_75del;531_532insG n/a
9 TRCN0000491954 CGATCTATCACAATTATAACCTTA pLX_317 76.9% 85.7% 85.8% V5 (not translated due to prior stop codon) 1_75del;531_532insT n/a
10 ccsbBroadEn_14715 pDONR223 100% 69.9% 75.7% None (many diffs) n/a
11 ccsbBroad304_14715 pLX_304 0% 69.9% 75.7% V5 (many diffs) n/a
12 TRCN0000469993 CCAAGGCATCGCGTCTCAAAGTAA pLX_317 72.2% 69.9% 75.7% V5 (many diffs) n/a
13 TRCN0000492213 TGTACTCCCGGGACTCAGACCACG pLX_317 92.3% 69.9% 75.7% V5 (not translated due to prior stop codon) (many diffs) n/a
14 ccsbBroadEn_10663 pDONR223 100% 57.7% 58.2% None (many diffs) n/a
15 ccsbBroad304_10663 pLX_304 0% 57.7% 58.2% V5 (many diffs) n/a
16 TRCN0000476918 CCTGTCGTTTGGTGACAACTCTGT pLX_317 33.8% 57.7% 58.2% V5 (many diffs) n/a
17 TRCN0000470841 CGTGCGTGAACAATGGCCCGGCTC pLX_317 40.9% 49% 12.4% V5 (not translated due to prior stop codon) (many diffs) n/a
18 ccsbBroadEn_15341 pDONR223 100% 48.8% 12.4% None (many diffs) n/a
19 ccsbBroad304_15341 pLX_304 0% 48.8% 12.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV