Transcript: Human NM_001018139.2

Homo sapiens NME/NM23 nucleoside diphosphate kinase 2 (NME2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
NME2 (4831)
Length:
682
CDS:
68..526

Additional Resources:

NCBI RefSeq record:
NM_001018139.2
NBCI Gene record:
NME2 (4831)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001018139.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196307 GAAATCAGCCTATGGTTTAAG pLKO.1 452 CDS 100% 13.200 6.600 Y NME2 n/a
2 TRCN0000234328 GAAATCAGCCTATGGTTTAAG pLKO_005 452 CDS 100% 13.200 6.600 Y NME1-NME2 n/a
3 TRCN0000318404 GAAATCAGCCTATGGTTTAAG pLKO_005 452 CDS 100% 13.200 6.600 Y NME2 n/a
4 TRCN0000218662 TCATGGCAGTGATTCAGTAAA pLKO_005 418 CDS 100% 13.200 6.600 Y NME1-NME2 n/a
5 TRCN0000381107 ACCAATCCAGCAGATTCAAAG pLKO_005 347 CDS 100% 10.800 5.400 Y NME2 n/a
6 TRCN0000010108 AGCACTACATTGACCTGAAAG pLKO.1 216 CDS 100% 10.800 5.400 Y NME2 n/a
7 TRCN0000234327 AGCACTACATTGACCTGAAAG pLKO_005 216 CDS 100% 10.800 5.400 Y NME1-NME2 n/a
8 TRCN0000349498 AGCACTACATTGACCTGAAAG pLKO_005 216 CDS 100% 10.800 5.400 Y NME2 n/a
9 TRCN0000381045 GGAGACCAATCCAGCAGATTC pLKO_005 343 CDS 100% 10.800 5.400 Y NME1-NME2 n/a
10 TRCN0000197030 GCTCATGACTGGGTCTATGAA pLKO.1 503 CDS 100% 5.625 2.813 Y NME2 n/a
11 TRCN0000318379 GCTCATGACTGGGTCTATGAA pLKO_005 503 CDS 100% 5.625 2.813 Y NME2 n/a
12 TRCN0000054518 GTTGGCAGGAACATCATTCAT pLKO.1 401 CDS 100% 5.625 2.813 Y Nme2 n/a
13 TRCN0000287722 GTTGGCAGGAACATCATTCAT pLKO_005 401 CDS 100% 5.625 2.813 Y Nme2 n/a
14 TRCN0000024906 ACATCATTCATGGCAGTGATT pLKO.1 411 CDS 100% 4.950 2.475 Y Nme2 n/a
15 TRCN0000379743 ATTCATGGCAGTGATTCAGTA pLKO_005 416 CDS 100% 4.950 2.475 Y NME2 n/a
16 TRCN0000010109 CCTATGGTTTAAGCCTGAAGA pLKO.1 460 CDS 100% 4.950 2.475 Y NME2 n/a
17 TRCN0000195380 CTGAAGAACTGGTTGACTACA pLKO.1 474 CDS 100% 4.950 2.475 Y NME2 n/a
18 TRCN0000234329 ACACAACAGCAGTCTCCTTCA pLKO_005 534 3UTR 100% 4.050 2.025 Y NME1-NME2 n/a
19 TRCN0000010110 TTTAAGCCTGAAGAACTGGTT pLKO.1 467 CDS 100% 2.640 1.320 Y NME2 n/a
20 TRCN0000199489 GACTTCTGCATTCAGGTTGGC pLKO.1 386 CDS 100% 2.160 1.080 Y NME2 n/a
21 TRCN0000318433 GACTTCTGCATTCAGGTTGGC pLKO_005 386 CDS 100% 2.160 1.080 Y NME2 n/a
22 TRCN0000010102 TTCATCGCCATCAAGCCGGAC pLKO.1 89 CDS 100% 0.400 0.200 Y NME2 n/a
23 TRCN0000199010 CAGAAGGGATTCCGCCTCGTG pLKO.1 155 CDS 100% 0.000 0.000 Y NME2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001018139.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14715 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_14715 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469993 CCAAGGCATCGCGTCTCAAAGTAA pLX_317 72.2% 100% 100% V5 n/a
4 TRCN0000492213 TGTACTCCCGGGACTCAGACCACG pLX_317 92.3% 100% 100% V5 (not translated due to prior stop codon) n/a
5 ccsbBroadEn_01101 pDONR223 100% 81.4% 88.1% None (many diffs) n/a
6 ccsbBroad304_01101 pLX_304 0% 81.4% 88.1% V5 (many diffs) n/a
7 TRCN0000468949 CACCGCTGGGTGCTAGCGAGCCCG pLX_317 73.3% 81.4% 88.1% V5 (many diffs) n/a
8 ccsbBroadEn_14714 pDONR223 0% 81.4% 88.1% None (many diffs) n/a
9 ccsbBroad304_14714 pLX_304 0% 81.4% 88.1% V5 (many diffs) n/a
10 TRCN0000479668 TTTTAGCACTCTCCAGTATATATA pLX_317 69.3% 81.4% 88.1% V5 (many diffs) n/a
11 TRCN0000488282 CTTCCTTTCGAGACTCGATGACCG pLX_317 63.2% 81.4% 88.1% V5 (not translated due to prior stop codon) (many diffs) n/a
12 TRCN0000489477 CTTACCCCATGCGATACCGACTGC pLX_317 56.7% 81.2% 87.5% V5 (many diffs) n/a
13 TRCN0000491954 CGATCTATCACAATTATAACCTTA pLX_317 76.9% 81.2% 88.1% V5 (not translated due to prior stop codon) (many diffs) n/a
14 TRCN0000470841 CGTGCGTGAACAATGGCCCGGCTC pLX_317 40.9% 56.8% 13.8% V5 (not translated due to prior stop codon) 0_1ins346 n/a
15 ccsbBroadEn_15341 pDONR223 100% 56.6% 13.8% None 0_1ins346;386A>N;445_446insG n/a
16 ccsbBroad304_15341 pLX_304 0% 56.6% 13.8% V5 (not translated due to prior stop codon) 0_1ins346;386A>N;445_446insG n/a
17 ccsbBroadEn_10663 pDONR223 100% 52% 52% None 0_1ins420 n/a
18 ccsbBroad304_10663 pLX_304 0% 52% 52% V5 0_1ins420 n/a
19 TRCN0000476918 CCTGTCGTTTGGTGACAACTCTGT pLX_317 33.8% 52% 52% V5 0_1ins420 n/a
Download CSV