Transcript: Mouse NM_001290800.1

Mus musculus TYRO3 protein tyrosine kinase 3 (Tyro3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Tyro3 (22174)
Length:
4469
CDS:
753..3383

Additional Resources:

NCBI RefSeq record:
NM_001290800.1
NBCI Gene record:
Tyro3 (22174)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290800.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361494 CTTGTGAAGCCCGCAACATAA pLKO_005 1315 CDS 100% 13.200 18.480 N Tyro3 n/a
2 TRCN0000361563 AGACCTAGCAGCTCGGAATTG pLKO_005 2672 CDS 100% 10.800 15.120 N Tyro3 n/a
3 TRCN0000023528 GCGAATGGAACTGGAGAACAT pLKO.1 3056 CDS 100% 4.950 6.930 N Tyro3 n/a
4 TRCN0000023525 GCCCGATCTTTCAATCGAGAA pLKO.1 2148 CDS 100% 4.050 5.670 N Tyro3 n/a
5 TRCN0000023527 CGCCATATGCTGGCATTGAAA pLKO.1 2902 CDS 100% 0.000 0.000 N Tyro3 n/a
6 TRCN0000361564 GGCTGAGCTGCTCCTACTTTA pLKO_005 3733 3UTR 100% 13.200 9.240 N Tyro3 n/a
7 TRCN0000361566 TCATTGCCTCAAGCGACATAG pLKO_005 2377 CDS 100% 10.800 7.560 N Tyro3 n/a
8 TRCN0000023526 GCAGCTTGCATGAAGGAGTTT pLKO.1 2415 CDS 100% 4.950 3.465 N Tyro3 n/a
9 TRCN0000023524 CCTCAGAATTTCCATGCCATT pLKO.1 1686 CDS 100% 4.050 2.835 N Tyro3 n/a
10 TRCN0000231525 TCATTGCCTCAAGCGACATTG pLKO_005 2377 CDS 100% 10.800 7.560 N TYRO3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290800.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14871 pDONR223 0% 84.4% 85.9% None (many diffs) n/a
2 ccsbBroad304_14871 pLX_304 0% 84.4% 85.9% V5 (many diffs) n/a
3 TRCN0000479963 TCCTTCCTGGCGGTACGGTCCTAA pLX_317 13.4% 84.4% 86% V5 (many diffs) n/a
4 ccsbBroadEn_15617 pDONR223 0% 84.4% 85.9% None (many diffs) n/a
5 ccsbBroad304_15617 pLX_304 0% 84.4% 85.9% V5 (many diffs) n/a
6 TRCN0000488607 GTCTTAGTGAACTGCAAAAATAAT pLX_317 14.6% 84.3% 85.9% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000489876 GCATTCACCTTCAGGTGAGCCTTG pLX_317 15.5% 84.3% 85.8% V5 (many diffs) n/a
8 ccsbBroadEn_13975 pDONR223 100% 84.3% 85.6% None (many diffs) n/a
9 ccsbBroad304_13975 pLX_304 0% 84.3% 85.6% V5 (not translated due to frame shift) (many diffs) n/a
10 TRCN0000474009 TGCGGAACTACTAATCCGCATTTC pLX_317 9.6% 84.3% 85.6% V5 (not translated due to frame shift) (many diffs) n/a
11 TRCN0000487789 GGTACCGAAATCCGACTACACCGA pLX_317 21.1% 43.2% 45% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV