Transcript: Human NM_006293.4

Homo sapiens TYRO3 protein tyrosine kinase (TYRO3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
TYRO3 (7301)
Length:
8032
CDS:
47..2719

Additional Resources:

NCBI RefSeq record:
NM_006293.4
NBCI Gene record:
TYRO3 (7301)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006293.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379716 GGGCATCAGCGATGAACTAAA pLKO_005 1540 CDS 100% 13.200 18.480 N TYRO3 n/a
2 TRCN0000231524 CCGGTCCTTCAATCGAGAAAG pLKO_005 1486 CDS 100% 10.800 15.120 N TYRO3 n/a
3 TRCN0000199533 GCCCTCATCCTGCTTCGAAAG pLKO.1 1385 CDS 100% 2.000 2.800 N TYRO3 n/a
4 TRCN0000231527 CCAGTGACTGTCGGTACATAC pLKO_005 2577 CDS 100% 10.800 8.640 N TYRO3 n/a
5 TRCN0000195673 CCCTGAACCTGTTACCATTGT pLKO.1 541 CDS 100% 4.950 3.960 N TYRO3 n/a
6 TRCN0000195244 CAAAGAGATGTCCTTGTAATA pLKO.1 3184 3UTR 100% 13.200 9.240 N TYRO3 n/a
7 TRCN0000231526 AGTGTATGGAGGACGTGTATG pLKO_005 2313 CDS 100% 10.800 7.560 N TYRO3 n/a
8 TRCN0000381303 TTCAACATCACCGTGACAAAG pLKO_005 731 CDS 100% 10.800 7.560 N TYRO3 n/a
9 TRCN0000231528 TTGGTATCTCAGGTCTGAATC pLKO_005 3234 3UTR 100% 10.800 7.560 N TYRO3 n/a
10 TRCN0000197199 GCTGCTTAAGTGCATGCATTG pLKO.1 3089 3UTR 100% 6.000 4.200 N TYRO3 n/a
11 TRCN0000195586 CCCTTCTAAACGGTGACCTTT pLKO.1 3550 3UTR 100% 4.950 3.465 N TYRO3 n/a
12 TRCN0000002181 CCTTCTCCATACCCACAATCT pLKO.1 3467 3UTR 100% 4.950 3.465 N TYRO3 n/a
13 TRCN0000002178 GAGTGTATGGAGGACGTGTAT pLKO.1 2312 CDS 100% 4.950 3.465 N TYRO3 n/a
14 TRCN0000002179 GTGGAGAGGAACTACGAAGAT pLKO.1 565 CDS 100% 4.950 3.465 N TYRO3 n/a
15 TRCN0000199890 GCCAGCTGTCTGTGCTATCTG pLKO.1 2418 CDS 100% 1.650 1.155 N TYRO3 n/a
16 TRCN0000231525 TCATTGCCTCAAGCGACATTG pLKO_005 1713 CDS 100% 10.800 6.480 N TYRO3 n/a
17 TRCN0000002180 CGAGCTTTACTTGTCTGCGAA pLKO.1 2376 CDS 100% 2.640 1.584 N TYRO3 n/a
18 TRCN0000010684 CGCTGAGATTTACAACTACCT pLKO.1 2260 CDS 100% 2.640 1.584 N TYRO3 n/a
19 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 4691 3UTR 100% 4.950 2.475 Y ERAP2 n/a
20 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 7625 3UTR 100% 4.950 2.475 Y n/a
21 TRCN0000023526 GCAGCTTGCATGAAGGAGTTT pLKO.1 1751 CDS 100% 4.950 2.475 Y Tyro3 n/a
22 TRCN0000023528 GCGAATGGAACTGGAGAACAT pLKO.1 2392 CDS 100% 4.950 2.475 Y Tyro3 n/a
23 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 4454 3UTR 100% 1.080 0.540 Y GPR83 n/a
24 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 4454 3UTR 100% 1.080 0.540 Y MYORG n/a
25 TRCN0000361566 TCATTGCCTCAAGCGACATAG pLKO_005 1713 CDS 100% 10.800 6.480 N Tyro3 n/a
26 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4692 3UTR 100% 13.200 6.600 Y LIAS n/a
27 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4050 3UTR 100% 5.625 2.813 Y KLHL30 n/a
28 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 4855 3UTR 100% 10.800 5.400 Y SMIM11A n/a
29 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4050 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006293.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14871 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_14871 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479963 TCCTTCCTGGCGGTACGGTCCTAA pLX_317 13.4% 99.9% 99.7% V5 2455C>A;2470A>G n/a
4 ccsbBroadEn_15617 pDONR223 0% 99.9% 100% None 747T>C n/a
5 ccsbBroad304_15617 pLX_304 0% 99.9% 100% V5 747T>C n/a
6 TRCN0000488607 GTCTTAGTGAACTGCAAAAATAAT pLX_317 14.6% 99.8% 99.5% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000489876 GCATTCACCTTCAGGTGAGCCTTG pLX_317 15.5% 99.7% 99.4% V5 (many diffs) n/a
8 ccsbBroadEn_13975 pDONR223 100% 99.7% 99.2% None (many diffs) n/a
9 ccsbBroad304_13975 pLX_304 0% 99.7% 99.2% V5 (not translated due to frame shift) (many diffs) n/a
10 TRCN0000474009 TGCGGAACTACTAATCCGCATTTC pLX_317 9.6% 99.7% 99.2% V5 (not translated due to frame shift) (many diffs) n/a
11 TRCN0000487789 GGTACCGAAATCCGACTACACCGA pLX_317 21.1% 47.4% 47.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV