Transcript: Mouse NM_001312869.1

Mus musculus transforming growth factor, beta receptor I (Tgfbr1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Tgfbr1 (21812)
Length:
5632
CDS:
193..1455

Additional Resources:

NCBI RefSeq record:
NM_001312869.1
NBCI Gene record:
Tgfbr1 (21812)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001312869.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022481 CCCATAGAGATTTGAAATCAA pLKO.1 932 CDS 100% 5.625 7.875 N Tgfbr1 n/a
2 TRCN0000322046 CACTTATGCTGATGGTCTATA pLKO_005 362 CDS 100% 13.200 10.560 N Tgfbr1 n/a
3 TRCN0000022482 GCACTTATGCTGATGGTCTAT pLKO.1 361 CDS 100% 4.950 3.960 N Tgfbr1 n/a
4 TRCN0000022483 GCTGACAGCTTTGCGAATTAA pLKO.1 1389 CDS 100% 15.000 10.500 N Tgfbr1 n/a
5 TRCN0000322044 GCTGACAGCTTTGCGAATTAA pLKO_005 1389 CDS 100% 15.000 10.500 N Tgfbr1 n/a
6 TRCN0000322107 ATATCTGCTCCTGGGTGTTTA pLKO_005 1486 3UTR 100% 13.200 9.240 N Tgfbr1 n/a
7 TRCN0000022480 GCCTTGAGAGTGATGGCTAAA pLKO.1 1330 CDS 100% 10.800 7.560 N Tgfbr1 n/a
8 TRCN0000022479 GCAGAGATTTATCAGACTGTA pLKO.1 679 CDS 100% 4.950 3.465 N Tgfbr1 n/a
9 TRCN0000322043 GCAGAGATTTATCAGACTGTA pLKO_005 679 CDS 100% 4.950 3.465 N Tgfbr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001312869.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488036 ATTCCCATATCGAACTAAAGTGCA pLX_317 22.1% 75.2% 73.2% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14861 pDONR223 100% 74.3% 19.7% None (many diffs) n/a
3 ccsbBroad304_14861 pLX_304 24.6% 74.3% 19.7% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000468797 GAGGTCCGTGGCCTGTTCCTGGGA pLX_317 25.8% 74.3% 19.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_01666 pDONR223 100% 73.3% 72.3% None (many diffs) n/a
6 ccsbBroad304_01666 pLX_304 52.7% 73.3% 72.3% V5 (many diffs) n/a
7 TRCN0000481423 ACACATGTGATGGCATCCCATCCC pLX_317 38.9% 73.3% 72.3% V5 (many diffs) n/a
Download CSV