Transcript: Human NM_000457.4

Homo sapiens hepatocyte nuclear factor 4 alpha (HNF4A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-18
Taxon:
Homo sapiens (human)
Gene:
HNF4A (3172)
Length:
4737
CDS:
118..1542

Additional Resources:

NCBI RefSeq record:
NM_000457.4
NBCI Gene record:
HNF4A (3172)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000457.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376471 CATGTACTCCTGCAGATTTAG pLKO_005 393 CDS 100% 13.200 18.480 N HNF4A n/a
2 TRCN0000376470 TCACCTGATGCAGGAACATAT pLKO_005 1290 CDS 100% 13.200 18.480 N HNF4A n/a
3 TRCN0000364310 TCAGGGTCTGAGCCCTATAAG pLKO_005 1438 CDS 100% 13.200 10.560 N HNF4A n/a
4 TRCN0000364311 ACATCAACGACCGCCAGTATG pLKO_005 1082 CDS 100% 10.800 8.640 N HNF4A n/a
5 TRCN0000019190 GCAGGAACATATGGGAACCAA pLKO.1 1299 CDS 100% 0.000 0.000 N HNF4A n/a
6 TRCN0000364379 ATGACTTGAGGCCTTACTTAA pLKO_005 1865 3UTR 100% 13.200 9.240 N HNF4A n/a
7 TRCN0000364308 GCCTACACCACCCTGGAATTT pLKO_005 181 CDS 100% 13.200 9.240 N HNF4A n/a
8 TRCN0000364381 ATCACCAAGCAGGAAGTTATC pLKO_005 1519 CDS 100% 10.800 7.560 N HNF4A n/a
9 TRCN0000364309 GTCATCGTTGCCAACACAATG pLKO_005 1321 CDS 100% 10.800 7.560 N HNF4A n/a
10 TRCN0000364314 TCTTCGGCATGGCCAAGATTG pLKO_005 1196 CDS 100% 10.800 7.560 N HNF4A n/a
11 TRCN0000364380 TTGACGCCCTGCTCTGGATAA pLKO_005 1717 3UTR 100% 10.800 7.560 N HNF4A n/a
12 TRCN0000019191 CCATCACCAAGCAGGAAGTTA pLKO.1 1517 CDS 100% 5.625 3.938 N HNF4A n/a
13 TRCN0000019193 ACCACCCTGGAATTTGAGAAT pLKO.1 187 CDS 100% 4.950 3.465 N HNF4A n/a
14 TRCN0000019189 CCACATGTACTCCTGCAGATT pLKO.1 390 CDS 100% 4.950 3.465 N HNF4A n/a
15 TRCN0000019192 CGAGCAGATCCAGTTCATCAA pLKO.1 1173 CDS 100% 4.950 3.465 N HNF4A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000457.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488427 CAGAGGCTTCAAGGCCATACACCA pLX_317 24.5% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000491796 TTGAAGTTAAAGATCCTGTCCCTC pLX_317 24.3% 99.9% 99.7% V5 1422_1423insG n/a
3 TRCN0000489372 CTCACCGCTACATTCTGCATATCG pLX_317 14.2% 84.8% 79.5% V5 (many diffs) n/a
4 ccsbBroadEn_00763 pDONR223 100% 84.7% 79.5% None (many diffs) n/a
5 ccsbBroad304_00763 pLX_304 0% 84.7% 79.5% V5 (many diffs) n/a
6 TRCN0000476469 AGCACACTGACAGTATAACCGGAG pLX_317 31.1% 84.7% 79.5% V5 (many diffs) n/a
7 TRCN0000489601 TACTGCCAAGAATCGACTGATGGC pLX_317 24.1% 84.7% 79.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV