Transcript: Human NM_000914.4

Homo sapiens opioid receptor mu 1 (OPRM1), transcript variant MOR-1, mRNA.

Source:
NCBI, updated 2019-08-18
Taxon:
Homo sapiens (human)
Gene:
OPRM1 (4988)
Length:
15279
CDS:
444..1646

Additional Resources:

NCBI RefSeq record:
NM_000914.4
NBCI Gene record:
OPRM1 (4988)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000914.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009274 CCGTAGTAACACATAAAGTAA pLKO.1 2021 3UTR 100% 5.625 7.875 N OPRM1 n/a
2 TRCN0000357703 TTATGCCAGTGCTCATCATTA pLKO_005 1174 CDS 100% 13.200 10.560 N OPRM1 n/a
3 TRCN0000011783 CGGCCAATACAGTGGATAGAA pLKO.1 1576 CDS 100% 5.625 4.500 N OPRM1 n/a
4 TRCN0000368502 TGATCTCCATAGATTACTATA pLKO_005 877 CDS 100% 13.200 9.240 N OPRM1 n/a
5 TRCN0000357704 TGTGAATTGAAGTCATCATAA pLKO_005 1915 3UTR 100% 13.200 9.240 N OPRM1 n/a
6 TRCN0000011784 CCAGAGTGTGAATTACCTAAT pLKO.1 818 CDS 100% 10.800 7.560 N OPRM1 n/a
7 TRCN0000009275 CGTGTGCTATGGACTGATGAT pLKO.1 1196 CDS 100% 4.950 3.465 N OPRM1 n/a
8 TRCN0000011785 GCATTGCTCTAGGTTACACAA pLKO.1 1411 CDS 100% 4.950 3.465 N OPRM1 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 12792 3UTR 100% 4.950 2.475 Y KAAG1 n/a
10 TRCN0000073413 CGCCTGTAATTCCAGCACTTT pLKO.1 9774 3UTR 100% 4.950 2.475 Y LILRB1 n/a
11 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 13347 3UTR 100% 1.080 0.540 Y GPR83 n/a
12 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 13347 3UTR 100% 1.080 0.540 Y MYORG n/a
13 TRCN0000027844 CTGGTCATGTATGTGATTGTA pLKO.1 711 CDS 100% 5.625 3.938 N Oprm1 n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 8984 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 8852 3UTR 100% 2.640 1.320 Y LINC01098 n/a
16 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 9937 3UTR 100% 10.800 5.400 Y SMIM11A n/a
17 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 8984 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000914.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01122 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01122 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000492306 TTGATCTCAAGGTTACTTTAACGC pLX_317 30.6% 86.5% 86.5% V5 (not translated due to prior stop codon) 0_1ins186;135C>T n/a
4 TRCN0000488117 GCCCGGGTCACCAAGCGACCACCG pLX_317 15.7% 86.4% 86.3% V5 0_1ins186;135C>T;1200_1201insG n/a
Download CSV