Transcript: Human NM_001003786.3

Homo sapiens STE20 related adaptor alpha (STRADA), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-11-22
Taxon:
Homo sapiens (human)
Gene:
STRADA (92335)
Length:
2242
CDS:
291..1475

Additional Resources:

NCBI RefSeq record:
NM_001003786.3
NBCI Gene record:
STRADA (92335)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001003786.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000284824 TGAATCTAGCAAGGTACAAAC pLKO_005 433 CDS 100% 10.800 15.120 N STRADA n/a
2 TRCN0000007049 CGTGACTGTACGGAGGATTAA pLKO.1 467 CDS 100% 13.200 10.560 N STRADA n/a
3 TRCN0000284822 CGTGACTGTACGGAGGATTAA pLKO_005 467 CDS 100% 13.200 10.560 N STRADA n/a
4 TRCN0000007048 CCATCCCAATATCGTGCCATA pLKO.1 557 CDS 100% 4.050 3.240 N STRADA n/a
5 TRCN0000272728 CCATCCCAATATCGTGCCATA pLKO_005 557 CDS 100% 4.050 3.240 N STRADA n/a
6 TRCN0000272738 TCAATAGCATCCTTCTCTAAA pLKO_005 324 CDS 100% 13.200 9.240 N STRADA n/a
7 TRCN0000195518 CAGCAACCTCAGCATGATAAG pLKO.1 824 CDS 100% 10.800 7.560 N STRADA n/a
8 TRCN0000007047 GCTGACTGATTGGGAAAGAAA pLKO.1 1608 3UTR 100% 5.625 3.938 N STRADA n/a
9 TRCN0000284826 GCTGACTGATTGGGAAAGAAA pLKO_005 1608 3UTR 100% 5.625 3.938 N STRADA n/a
10 TRCN0000197062 GCTGTGGGTTGTCACATCATT pLKO.1 605 CDS 100% 5.625 3.938 N STRADA n/a
11 TRCN0000007051 CACTGTGATAGGCAAAGGATT pLKO.1 395 CDS 100% 4.950 3.465 N STRADA n/a
12 TRCN0000195667 CAAGTACAGTGTCAAGGTTCT pLKO.1 881 CDS 100% 4.050 2.835 N STRADA n/a
13 TRCN0000200013 CCTGTTGGATACCAGCACCAT pLKO.1 1073 CDS 100% 2.640 1.848 N STRADA n/a
14 TRCN0000007050 CAGCAGAATCTCCAGGGTTAT pLKO.1 927 CDS 100% 10.800 6.480 N STRADA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001003786.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487854 GAATGTCTAGGATGTCATATAACA pLX_317 21.7% 97.9% 97.7% V5 (not translated due to prior stop codon) 12_13ins24;1055C>T n/a
2 TRCN0000488716 GGTCGCGAGCCGTTCCGTTTAGGT pLX_317 17.8% 64.2% 73.7% V5 (not translated due to prior stop codon) 12_13ins111;985_986ins293;1029_1030ins253 n/a
3 TRCN0000491266 TCCCTCTTGAAAGCGGACAAACCA pLX_317 13.9% 64.2% 73.7% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_12979 pDONR223 100% 58.3% 57.3% None (many diffs) n/a
5 ccsbBroad304_12979 pLX_304 0% 58.3% 57.3% V5 (many diffs) n/a
6 TRCN0000471765 ATCATTTCTTACTGCGCAAGTCCT pLX_317 64.4% 58.3% 57.3% V5 (many diffs) n/a
7 ccsbBroadEn_15217 pDONR223 0% 58.3% 57.3% None (many diffs) n/a
8 ccsbBroad304_15217 pLX_304 0% 58.3% 57.3% V5 (many diffs) n/a
9 TRCN0000481363 CTTCCTGGCGGTTGGATTAAAATA pLX_317 70.2% 58.3% 57.3% V5 (many diffs) n/a
Download CSV