Transcript: Human NM_001011515.2

Homo sapiens PDZ and LIM domain 5 (PDLIM5), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-07
Taxon:
Homo sapiens (human)
Gene:
PDLIM5 (10611)
Length:
2031
CDS:
182..886

Additional Resources:

NCBI RefSeq record:
NM_001011515.2
NBCI Gene record:
PDLIM5 (10611)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001011515.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029739 CCCAGAATAAGATTAAGGGTT pLKO.1 378 CDS 100% 2.640 2.112 N PDLIM5 n/a
2 TRCN0000276400 AGAATCTGAAGCCGATAATAC pLKO_005 760 CDS 100% 13.200 9.240 N PDLIM5 n/a
3 TRCN0000088639 TCACGTCTTTAGTCCCAAATA pLKO.1 808 CDS 100% 13.200 9.240 N Pdlim5 n/a
4 TRCN0000088640 CTTCACGTCTTTAGTCCCAAA pLKO.1 806 CDS 100% 4.050 2.835 N Pdlim5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001011515.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07649 pDONR223 100% 89.8% 87.6% None (many diffs) n/a
2 ccsbBroad304_07649 pLX_304 0% 89.8% 87.6% V5 (many diffs) n/a
3 TRCN0000475444 CAAGGGATGGAAGCCACCAATCTA pLX_317 57.8% 89.8% 87.6% V5 (many diffs) n/a
4 ccsbBroadEn_07648 pDONR223 100% 36.1% 33% None (many diffs) n/a
5 ccsbBroad304_07648 pLX_304 0% 36.1% 33% V5 (many diffs) n/a
6 TRCN0000480419 AGTGTAATCATCCGAGAGCCTTTT pLX_317 24.1% 36.1% 33% V5 (many diffs) n/a
Download CSV