Transcript: Human NM_001012506.5

Homo sapiens coiled-coil domain containing 66 (CCDC66), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-12-05
Taxon:
Homo sapiens (human)
Gene:
CCDC66 (285331)
Length:
3145
CDS:
171..2915

Additional Resources:

NCBI RefSeq record:
NM_001012506.5
NBCI Gene record:
CCDC66 (285331)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001012506.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000445479 AGACTAGAAACACCGTAAATA pLKO_005 427 CDS 100% 15.000 21.000 N CCDC66 n/a
2 TRCN0000134816 CAAATAGAAGATGACCGTCAA pLKO.1 1083 CDS 100% 4.050 5.670 N CCDC66 n/a
3 TRCN0000137299 GATCGACAGCAAGCAATCCTT pLKO.1 2784 CDS 100% 3.000 4.200 N CCDC66 n/a
4 TRCN0000135179 CTGAGATTTCGGCAGAACTTA pLKO.1 1996 CDS 100% 5.625 3.938 N CCDC66 n/a
5 TRCN0000166977 CCTTCACATTTGATTTGTGTC pLKO.1 2932 3UTR 100% 4.050 2.835 N CCDC66 n/a
6 TRCN0000136134 GCTGTGAAACAAGAACTGCAA pLKO.1 1035 CDS 100% 2.640 1.848 N CCDC66 n/a
7 TRCN0000450143 ATGGAATATAATGCATCTAAC pLKO_005 1794 CDS 100% 10.800 6.480 N CCDC66 n/a
8 TRCN0000215849 CGAACAAATGAGATCTATTAT pLKO.1 2619 CDS 100% 15.000 12.000 N Ccdc66 n/a
9 TRCN0000215671 GATCCACTTCTTAATCCTAAA pLKO.1 2748 CDS 100% 10.800 7.560 N Ccdc66 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001012506.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13547 pDONR223 100% 96.2% 96.2% None (many diffs) n/a
2 ccsbBroad304_13547 pLX_304 0% 96.2% 96.2% V5 (many diffs) n/a
3 TRCN0000467805 CCGAGTCAACCCACACGCTCAACA pLX_317 16.3% 96.2% 96.2% V5 (many diffs) n/a
4 ccsbBroadEn_13548 pDONR223 100% 90.8% 90.7% None (many diffs) n/a
5 ccsbBroad304_13548 pLX_304 0% 90.8% 90.7% V5 (many diffs) n/a
6 TRCN0000481320 AAGGAACGAACGTCACCAATACCA pLX_317 13% 90.8% 90.7% V5 (many diffs) n/a
Download CSV