Transcript: Human NM_001040661.2

Homo sapiens solute carrier family 29 member 4 (SLC29A4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
SLC29A4 (222962)
Length:
5667
CDS:
152..1744

Additional Resources:

NCBI RefSeq record:
NM_001040661.2
NBCI Gene record:
SLC29A4 (222962)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001040661.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043700 AGTGCAGCAATCCAGCTTCTA pLKO.1 694 CDS 100% 4.950 6.930 N SLC29A4 n/a
2 TRCN0000420801 GACCTCCATCGTGTTTGACAT pLKO_005 454 CDS 100% 4.950 3.960 N SLC29A4 n/a
3 TRCN0000043698 GCTGCCATACAACAGCTTCAT pLKO.1 397 CDS 100% 4.950 3.465 N SLC29A4 n/a
4 TRCN0000443399 AGCTTCACCTTCGACAGTCAC pLKO_005 224 CDS 100% 4.050 2.835 N SLC29A4 n/a
5 TRCN0000444213 TGTCCTCCTGAACAACGTCCT pLKO_005 508 CDS 100% 2.160 1.512 N SLC29A4 n/a
6 TRCN0000043701 CCTGTCAGACTTCGTGGGCAA pLKO.1 1339 CDS 100% 0.720 0.504 N SLC29A4 n/a
7 TRCN0000082462 CCTCCCAAAGTGCCAGGATTA pLKO.1 3875 3UTR 100% 10.800 5.400 Y LOC388949 n/a
8 TRCN0000060503 CCTCTCAAGTAGCTGGGATTA pLKO.1 3434 3UTR 100% 10.800 5.400 Y NCCRP1 n/a
9 TRCN0000155576 CCTCTCAAGTAGCTGGGATTA pLKO.1 3434 3UTR 100% 10.800 5.400 Y KLHL30 n/a
10 TRCN0000165697 CCTCTCAAGTAGCTGGGATTA pLKO.1 3434 3UTR 100% 10.800 5.400 Y SLC48A1 n/a
11 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 4874 3UTR 100% 4.950 2.475 Y LOC387873 n/a
12 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 3563 3UTR 100% 1.080 0.540 Y GPR83 n/a
13 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 3563 3UTR 100% 1.080 0.540 Y MYORG n/a
14 TRCN0000079757 GTGTTCAACCTGTCAGACTTT pLKO.1 1331 CDS 100% 4.950 3.465 N Slc29a4 n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4619 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4619 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001040661.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489419 ATGACAAGACAACCAGGTTGATTC pLX_317 21.2% 100% 100% V5 (not translated due to prior stop codon) n/a
2 ccsbBroadEn_13440 pDONR223 100% 97.2% 91.7% None 413_449del;542_546delCAGTG;978T>C n/a
3 ccsbBroad304_13440 pLX_304 0% 97.2% 91.7% V5 413_449del;542_546delCAGTG;978T>C n/a
4 TRCN0000469666 CTCTACGCATCGAGTATTAGCCCC pLX_317 17.4% 97.2% 91.7% V5 413_449del;542_546delCAGTG;978T>C n/a
Download CSV