Transcript: Human NM_001074.4

Homo sapiens UDP glucuronosyltransferase family 2 member B7 (UGT2B7), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-18
Taxon:
Homo sapiens (human)
Gene:
UGT2B7 (7364)
Length:
1888
CDS:
48..1637

Additional Resources:

NCBI RefSeq record:
NM_001074.4
NBCI Gene record:
UGT2B7 (7364)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001074.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036205 AGTACAGGAAATCATGTCAAT pLKO.1 380 CDS 100% 4.950 3.960 N UGT2B7 n/a
2 TRCN0000036204 GCAAGAAAGATTGTGATGCAA pLKO.1 1697 3UTR 100% 3.000 2.100 N UGT2B7 n/a
3 TRCN0000036208 CCTAAGGAAATGGAAGACTTT pLKO.1 912 CDS 100% 4.950 2.970 N UGT2B7 n/a
4 TRCN0000036207 CCTGTTGTTATGTCAGAATTA pLKO.1 630 CDS 100% 13.200 6.600 Y UGT2B7 n/a
5 TRCN0000034732 CGAGCAGTCTTCTGGATTGAA pLKO.1 1422 CDS 100% 5.625 2.813 Y UGT2B28 n/a
6 TRCN0000036206 CTGGTTCCAGTACCACTCTTT pLKO.1 1499 CDS 100% 4.950 2.475 Y UGT2B7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001074.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13979 pDONR223 100% 99.9% 99.2% None 1573delA n/a
2 ccsbBroad304_13979 pLX_304 0% 99.9% 99.2% V5 (not translated due to frame shift) 1573delA n/a
3 TRCN0000480649 GTATCCTGATATGCGTTGCTGGGC pLX_317 26.8% 99.9% 99.2% V5 (not translated due to frame shift) 1573delA n/a
4 ccsbBroadEn_01752 pDONR223 100% 92.6% 87.5% None (many diffs) n/a
5 ccsbBroad304_01752 pLX_304 0% 92.6% 87.5% V5 (many diffs) n/a
6 ccsbBroadEn_02514 pDONR223 100% 91.8% 85.6% None (many diffs) n/a
7 ccsbBroad304_02514 pLX_304 0% 91.8% 85.6% V5 (many diffs) n/a
8 ccsbBroadEn_10448 pDONR223 100% 90.1% 85.2% None (many diffs) n/a
9 ccsbBroad304_10448 pLX_304 0% 90.1% 85.2% V5 (not translated due to frame shift) (many diffs) n/a
10 TRCN0000471029 ATGCGTCAATATGTCCGATAACAC pLX_317 30.6% 90.1% 85.2% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV