Transcript: Human NM_001079881.1

Homo sapiens protein kinase D2 (PRKD2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-26
Taxon:
Homo sapiens (human)
Gene:
PRKD2 (25865)
Length:
3202
CDS:
343..2979

Additional Resources:

NCBI RefSeq record:
NM_001079881.1
NBCI Gene record:
PRKD2 (25865)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001079881.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001949 CGTGGCAGTTAAGGTCATTGA pLKO.1 2070 CDS 100% 4.950 6.930 N PRKD2 n/a
2 TRCN0000342322 CGTGGCAGTTAAGGTCATTGA pLKO_005 2070 CDS 100% 4.950 6.930 N PRKD2 n/a
3 TRCN0000001950 CACGACCAACAGATACTATAA pLKO.1 1638 CDS 100% 13.200 9.240 N PRKD2 n/a
4 TRCN0000342248 CACGACCAACAGATACTATAA pLKO_005 1638 CDS 100% 13.200 9.240 N PRKD2 n/a
5 TRCN0000001948 CTTCTACGGCCTTTACGACAA pLKO.1 597 CDS 100% 4.050 2.835 N PRKD2 n/a
6 TRCN0000352606 CTTCTACGGCCTTTACGACAA pLKO_005 597 CDS 100% 4.050 2.835 N PRKD2 n/a
7 TRCN0000001947 CAGTTTGGAGTGGTCTATGGA pLKO.1 2023 CDS 100% 3.000 2.100 N PRKD2 n/a
8 TRCN0000010670 GTTGGGTGGTTCATTACAGCA pLKO.1 1547 CDS 100% 2.640 1.848 N PRKD2 n/a
9 TRCN0000342320 GTTGGGTGGTTCATTACAGCA pLKO_005 1547 CDS 100% 2.640 1.848 N PRKD2 n/a
10 TRCN0000199598 GCTCGCATCATCGGCGAGAAG pLKO.1 2437 CDS 100% 0.000 0.000 N PRKD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001079881.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489002 TGTACTAACTGGCCAATTCCGCAC pLX_317 15.1% 100% 100% V5 (not translated due to prior stop codon) n/a
2 ccsbBroadEn_15028 pDONR223 59.1% 99.6% 29.6% None (many diffs) n/a
3 ccsbBroad304_15028 pLX_304 0% 99.6% 29.6% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000473412 CTACGTAAAGGCGACCATTCGTTG pLX_317 15% 99.6% 29.6% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489157 CTATACTAGACCGTTATTCTAATG pLX_317 21.4% 61.2% 61.2% V5 (not translated due to prior stop codon) 1_1020del n/a
Download CSV