Transcript: Human NM_001098535.1

Homo sapiens ret finger protein like 3 (RFPL3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
RFPL3 (10738)
Length:
1488
CDS:
206..1159

Additional Resources:

NCBI RefSeq record:
NM_001098535.1
NBCI Gene record:
RFPL3 (10738)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001098535.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033754 GCTCCTTCAATTCCACCTAAT pLKO.1 1055 CDS 100% 10.800 6.480 N RFPL3 n/a
2 TRCN0000291859 GCTCCTTCAATTCCACCTAAT pLKO_005 1055 CDS 100% 10.800 6.480 N RFPL3 n/a
3 TRCN0000033755 CCGCTGACTTTCCTCTTAGTA pLKO.1 899 CDS 100% 5.625 3.375 N RFPL3 n/a
4 TRCN0000291860 CCGCTGACTTTCCTCTTAGTA pLKO_005 899 CDS 100% 5.625 3.375 N RFPL3 n/a
5 TRCN0000033757 GCTTTGCTGTTGCTGTTCCAT pLKO.1 433 CDS 100% 3.000 1.800 N RFPL3 n/a
6 TRCN0000310091 GCTTTGCTGTTGCTGTTCCAT pLKO_005 433 CDS 100% 3.000 1.800 N RFPL3 n/a
7 TRCN0000033758 GCGGAAGTTCCAAGTGGATAT pLKO.1 565 CDS 100% 10.800 5.400 Y RFPL3 n/a
8 TRCN0000033756 CCCAAGCTGAAGAAGATTCTA pLKO.1 527 CDS 100% 5.625 2.813 Y RFPL3 n/a
9 TRCN0000291861 CCCAAGCTGAAGAAGATTCTA pLKO_005 527 CDS 100% 5.625 2.813 Y RFPL3 n/a
10 TRCN0000033689 GCCAACAACTTCCTCCTCATT pLKO.1 605 CDS 100% 4.950 2.475 Y RFPL1 n/a
11 TRCN0000033693 CGAGAGATTTGACGTGTCCAT pLKO.1 685 CDS 100% 2.640 1.320 Y RFPL1 n/a
12 TRCN0000033762 GTCTATACATTCAGGAGCGTA pLKO.1 1004 CDS 100% 2.640 1.320 Y RFPL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001098535.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07672 pDONR223 100% 90.6% 90.5% None 1_87del;328C>A;879A>G n/a
2 ccsbBroad304_07672 pLX_304 0% 90.6% 90.5% V5 1_87del;328C>A;879A>G n/a
3 ccsbBroadEn_02517 pDONR223 100% 88.5% 85.8% None (many diffs) n/a
4 ccsbBroad304_02517 pLX_304 0% 88.5% 85.8% V5 (many diffs) n/a
5 TRCN0000481078 GTATTACCAGGTGCGATTAGCTGT pLX_317 51.6% 88.5% 85.8% V5 (many diffs) n/a
Download CSV