Transcript: Human NM_001127323.1

Homo sapiens glutamate metabotropic receptor 8 (GRM8), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
GRM8 (2918)
Length:
3873
CDS:
558..3284

Additional Resources:

NCBI RefSeq record:
NM_001127323.1
NBCI Gene record:
GRM8 (2918)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001127323.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363196 GTGACCTTTGTCCGCTATAAT pLKO_005 2364 CDS 100% 15.000 21.000 N GRM8 n/a
2 TRCN0000219404 CAAACCGTATCCACCGAATAT pLKO.1 2566 CDS 100% 13.200 18.480 N Grm8 n/a
3 TRCN0000363183 CAAACCGTATCCACCGAATAT pLKO_005 2566 CDS 100% 13.200 18.480 N GRM8 n/a
4 TRCN0000009040 CGACAAGATTTCTGGCGTCAT pLKO.1 989 CDS 100% 4.050 3.240 N GRM8 n/a
5 TRCN0000363152 CCATCATGGTTGCTAACATTT pLKO_005 1033 CDS 100% 13.200 9.240 N GRM8 n/a
6 TRCN0000219406 CTTGCCAATAATCGAAGAAAT pLKO.1 1605 CDS 100% 13.200 9.240 N Grm8 n/a
7 TRCN0000219409 CTTGTACTGTTTATGCCATTA pLKO.1 2842 CDS 100% 10.800 7.560 N Grm8 n/a
8 TRCN0000009038 CCCACATTGTTTAACTTGTAT pLKO.1 3700 3UTR 100% 5.625 3.938 N GRM8 n/a
9 TRCN0000009039 CCGCTATAATGACACACCTAT pLKO.1 2375 CDS 100% 4.950 3.465 N GRM8 n/a
10 TRCN0000009041 CCTGCATCATTTGGTTAGCTT pLKO.1 2926 CDS 100% 3.000 2.100 N GRM8 n/a
11 TRCN0000009042 GCTAAGTGATAACACCAGGTA pLKO.1 1103 CDS 100% 2.640 1.848 N GRM8 n/a
12 TRCN0000219405 GATGACATCAGGAGGATATTG pLKO.1 1410 CDS 100% 13.200 7.920 N Grm8 n/a
13 TRCN0000363156 GATGACATCAGGAGGATATTG pLKO_005 1410 CDS 100% 13.200 7.920 N GRM8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127323.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489666 CTGTACCGCGCATAGGTGACCTTG pLX_317 13% 99.9% 99.7% V5 (not translated due to prior stop codon) 235A>G;1085T>A n/a
2 TRCN0000487954 AGCGCTCGGAAATCGTTCTGTCGG pLX_317 12.3% 99.8% 99.6% V5 235A>G;1085T>A;2724_2725insG n/a
3 TRCN0000492137 GATTACATGGCCTACAAACTATCG pLX_317 12.5% 98.5% 98.4% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000489225 CGCAGCTCTTTACGAAAGTTGGCA pLX_317 12.4% 98.5% 98.3% V5 (many diffs) n/a
5 ccsbBroadEn_06327 pDONR223 100% 98.5% 98.2% None (many diffs) n/a
6 ccsbBroad304_06327 pLX_304 0% 98.5% 98.2% V5 (many diffs) n/a
7 TRCN0000477307 TTAGTATTTATGGTTTTCTTGATC pLX_317 16.8% 98.5% 98.2% V5 (many diffs) n/a
Download CSV