Transcript: Human NM_001130022.1

Homo sapiens zinc finger protein 680 (ZNF680), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
ZNF680 (340252)
Length:
2288
CDS:
174..545

Additional Resources:

NCBI RefSeq record:
NM_001130022.1
NBCI Gene record:
ZNF680 (340252)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001130022.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107337 GCCTCACCTGATAACCTGTTT pLKO.1 347 CDS 100% 4.950 3.465 N ZNF680 n/a
2 TRCN0000016587 CCTGGGTATTGCTGTCTCTAA pLKO.1 326 CDS 100% 4.950 2.475 Y ZNF675 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001130022.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11384 pDONR223 100% 65.6% 60.1% None (many diffs) n/a
2 ccsbBroad304_11384 pLX_304 0% 65.6% 60.1% V5 (many diffs) n/a
3 TRCN0000470576 TACATACAGACCTACACGTAGACC pLX_317 100% 65.6% 60.1% V5 (many diffs) n/a
4 ccsbBroadEn_15729 pDONR223 0% 58% 53.6% None (many diffs) n/a
5 ccsbBroad304_15729 pLX_304 0% 58% 53.6% V5 (many diffs) n/a
6 TRCN0000470492 GCCGACTTGCTCCATGATGCAGCT pLX_317 100% 58% 53.6% V5 (many diffs) n/a
7 ccsbBroadEn_13746 pDONR223 100% 55.2% 50.4% None (many diffs) n/a
8 ccsbBroad304_13746 pLX_304 0% 55.2% 50.4% V5 (many diffs) n/a
9 TRCN0000475669 ATTCGCAGCGAGTTTGTCCGCCGC pLX_317 100% 55.2% 50.4% V5 (many diffs) n/a
10 ccsbBroadEn_11549 pDONR223 100% 33.9% 30.8% None (many diffs) n/a
11 ccsbBroad304_11549 pLX_304 94.6% 33.9% 30.8% V5 (many diffs) n/a
12 TRCN0000468281 AACATTAGGAAAGAACCCCCACCC pLX_317 100% 33.9% 30.8% V5 (many diffs) n/a
13 ccsbBroadEn_10024 pDONR223 100% 19.9% 17.9% None (many diffs) n/a
14 ccsbBroad304_10024 pLX_304 0% 19.9% 17.9% V5 (many diffs) n/a
15 TRCN0000466950 AAAAATGGGCGCTCTGAGACACAC pLX_317 21.1% 19.9% 17.9% V5 (many diffs) n/a
Download CSV