Transcript: Human NM_001166038.2

Homo sapiens zinc finger protein 260 (ZNF260), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ZNF260 (339324)
Length:
5266
CDS:
715..1953

Additional Resources:

NCBI RefSeq record:
NM_001166038.2
NBCI Gene record:
ZNF260 (339324)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001166038.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149798 GCCTTTAACGGCAAAGCATAT pLKO.1 1144 CDS 100% 10.800 15.120 N ZNF260 n/a
2 TRCN0000148795 CGAGTCTCATCTCTTACTCTA pLKO.1 910 CDS 100% 4.950 3.960 N ZNF260 n/a
3 TRCN0000147981 CCAGAAGCAATACCTCATTAA pLKO.1 1236 CDS 100% 13.200 9.240 N ZNF260 n/a
4 TRCN0000147833 GCAGAAGCAATACCTCATTAA pLKO.1 1572 CDS 100% 13.200 9.240 N ZNF260 n/a
5 TRCN0000147050 CCAGAATAACTAGGACTCAAA pLKO.1 5024 3UTR 100% 4.950 3.465 N ZNF260 n/a
6 TRCN0000149799 GAATCAGATCTCCTTCAGCAT pLKO.1 745 CDS 100% 2.640 1.848 N ZNF260 n/a
7 TRCN0000149689 GCTCATCTCTTACTGTGCATA pLKO.1 1745 CDS 100% 4.950 2.970 N ZNF260 n/a
8 TRCN0000239829 AGGAGAGAAACCCTATGAATG pLKO_005 1611 CDS 100% 10.800 5.400 Y Gm14393 n/a
9 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 4538 3UTR 100% 10.800 5.400 Y MRPS16 n/a
10 TRCN0000156198 CCTCTTGAGTAGCTGGGATTA pLKO.1 4404 3UTR 100% 10.800 5.400 Y MRPL49 n/a
11 TRCN0000276507 CCTCTTGAGTAGCTGGGATTA pLKO_005 4404 3UTR 100% 10.800 5.400 Y MRPL49 n/a
12 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 779 CDS 100% 5.625 2.813 Y ZNF345 n/a
13 TRCN0000148848 CATACAGGTGAGAAACCCTAT pLKO.1 1774 CDS 100% 4.050 2.025 Y ZNF260 n/a
14 TRCN0000149285 GCATGTAAGGAATGTGGCAAA pLKO.1 1123 CDS 100% 4.050 2.025 Y ZNF260 n/a
15 TRCN0000165704 CAATGGCACAATCTTGGCTCA pLKO.1 4339 3UTR 100% 2.160 1.080 Y LOC652276 n/a
16 TRCN0000262238 TACAGGAGAGAAACCCTATAA pLKO_005 1608 CDS 100% 13.200 6.600 Y Gm14305 n/a
17 TRCN0000284648 ATACAGGAGAGAAACCCTATA pLKO_005 1607 CDS 100% 10.800 5.400 Y Gm14308 n/a
18 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 4538 3UTR 100% 10.800 5.400 Y CD3EAP n/a
19 TRCN0000239543 ACAGGAGAGAAACCTTATAAA pLKO_005 1441 CDS 100% 15.000 7.500 Y Gm13212 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166038.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10011 pDONR223 100% 99.9% 100% None 1050T>C n/a
2 ccsbBroad304_10011 pLX_304 0% 99.9% 100% V5 1050T>C n/a
3 TRCN0000477743 TGCCCTAATGTTTGGACCTAGTTT pLX_317 33.5% 99.9% 100% V5 1050T>C n/a
4 ccsbBroadEn_10010 pDONR223 100% 99.8% 100% None 1203A>G;1233T>C n/a
5 ccsbBroad304_10010 pLX_304 0% 99.8% 100% V5 1203A>G;1233T>C n/a
6 TRCN0000491758 AAAGACCTTGCATTATAACTTTTC pLX_317 34.4% 99.8% 100% V5 1203A>G;1233T>C n/a
7 ccsbBroadEn_07166 pDONR223 100% 59.8% 57.2% None (many diffs) n/a
8 ccsbBroad304_07166 pLX_304 0% 59.8% 57.2% V5 (many diffs) n/a
9 TRCN0000470510 CGGGCCCGCTCCGTTGCACCGGGG pLX_317 41.2% 59.8% 57.2% V5 (many diffs) n/a
Download CSV