Transcript: Human NM_001174067.1

Homo sapiens fibroblast growth factor receptor 1 (FGFR1), transcript variant 14, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
FGFR1 (2260)
Length:
5375
CDS:
324..2885

Additional Resources:

NCBI RefSeq record:
NM_001174067.1
NBCI Gene record:
FGFR1 (2260)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146877 ACAGTGTGTACCTTCCAGAA pXPR_003 CGG 1168 46% 9 1.4819 FGFR1 FGFR1 76068
2 BRDN0001145494 CTGGTCTTAGGCAAACCCCT pXPR_003 GGG 1541 60% 12 0.3271 FGFR1 FGFR1 76067
3 BRDN0001146517 GTTGCCCGCCAACAAAACAG pXPR_003 TGG 889 35% 8 0.2642 FGFR1 FGFR1 76069
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001174067.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121182 GTGGTGCCAGTGGCTTATTAA pLKO.1 3371 3UTR 100% 15.000 21.000 N FGFR1 n/a
2 TRCN0000121311 GAATGAGTACGGCAGCATCAA pLKO.1 1115 CDS 100% 4.950 6.930 N FGFR1 n/a
3 TRCN0000121183 TGGAGTTAATACCACCGACAA pLKO.1 1358 CDS 100% 4.050 5.670 N FGFR1 n/a
4 TRCN0000121308 GCTTGCCAATGGCGGACTCAA pLKO.1 2855 CDS 100% 1.650 2.310 N FGFR1 n/a
5 TRCN0000121103 CCGGCCTCTATGCTTGCGTAA pLKO.1 709 CDS 100% 1.350 1.890 N FGFR1 n/a
6 TRCN0000312516 GATGGCACCCGAGGCATTATT pLKO_005 2414 CDS 100% 15.000 12.000 N FGFR1 n/a
7 TRCN0000381505 GAGTTAATACCACCGACAAAG pLKO_005 1360 CDS 100% 10.800 8.640 N FGFR1 n/a
8 TRCN0000121104 CGGGAAGCATAAGAATATCAT pLKO.1 2030 CDS 100% 5.625 4.500 N FGFR1 n/a
9 TRCN0000121185 CCACAGAATTGGAGGCTACAA pLKO.1 1016 CDS 100% 4.950 3.960 N FGFR1 n/a
10 TRCN0000312572 CCACAGAATTGGAGGCTACAA pLKO_005 1016 CDS 100% 4.950 3.960 N FGFR1 n/a
11 TRCN0000195394 CCACTCCTCAGTCGCTATATT pLKO.1 4837 3UTR 100% 15.000 10.500 N FGFR1 n/a
12 TRCN0000429862 TGAAGACTGCTGGAGTTAATA pLKO_005 1348 CDS 100% 15.000 10.500 N Fgfr1 n/a
13 TRCN0000199475 GCTGCAGTGTTGGCGACTATT pLKO.1 4974 3UTR 100% 13.200 9.240 N FGFR1 n/a
14 TRCN0000312574 TGCCACCTGGAGCATCATAAT pLKO_005 1046 CDS 100% 13.200 9.240 N FGFR1 n/a
15 TRCN0000427411 CCACCTACTTCTCCGTCAATG pLKO_005 754 CDS 100% 10.800 7.560 N Fgfr1 n/a
16 TRCN0000121105 GCCAAGACAGTGAAGTTCAAA pLKO.1 927 CDS 100% 5.625 3.938 N FGFR1 n/a
17 TRCN0000000421 AGGGCTGGAATACTGCTACAA pLKO.1 2153 CDS 100% 4.950 3.465 N FGFR1 n/a
18 TRCN0000195683 CGCAGATCTTGGCTTCTTACA pLKO.1 4654 3UTR 100% 4.950 3.465 N FGFR1 n/a
19 TRCN0000121106 GAGATGGAGGTGCTTCACTTA pLKO.1 1380 CDS 100% 4.950 3.465 N FGFR1 n/a
20 TRCN0000121186 TCTTGAAGACTGCTGGAGTTA pLKO.1 1345 CDS 100% 4.950 3.465 N FGFR1 n/a
21 TRCN0000121307 AGTGGCTTATTAATTCCGATA pLKO.1 3379 3UTR 100% 4.050 2.835 N FGFR1 n/a
22 TRCN0000327645 AGTGGCTTATTAATTCCGATA pLKO_005 3379 3UTR 100% 4.050 2.835 N FGFR1 n/a
23 TRCN0000121309 CTTGTATGTCATCGTGGAGTA pLKO.1 2084 CDS 100% 4.050 2.835 N FGFR1 n/a
24 TRCN0000199308 CGCAGGATGGTCCCTTGTATG pLKO.1 2071 CDS 100% 3.600 2.520 N FGFR1 n/a
25 TRCN0000000420 CGTCAATGTTTCAGATGCTCT pLKO.1 767 CDS 100% 2.640 1.848 N FGFR1 n/a
26 TRCN0000000417 CGTTACCAGAGATTTACCCAT pLKO.1 3577 3UTR 100% 2.640 1.848 N FGFR1 n/a
27 TRCN0000000418 CGAGGCATTATTTGACCGGAT pLKO.1 2423 CDS 100% 2.160 1.512 N FGFR1 n/a
28 TRCN0000121102 CCCTCCCAGATGTTGGACCAA pLKO.1 3126 3UTR 100% 0.880 0.616 N FGFR1 n/a
29 TRCN0000312573 CCCTCCCAGATGTTGGACCAA pLKO_005 3126 3UTR 100% 0.880 0.616 N FGFR1 n/a
30 TRCN0000199924 GCCCAGTAACTGCACCAACGA pLKO.1 2579 CDS 100% 0.880 0.616 N FGFR1 n/a
31 TRCN0000121310 CAAGATGAAGAGTGGTACCAA pLKO.1 1607 CDS 100% 0.000 0.000 N FGFR1 n/a
32 TRCN0000000419 CAGAGGAGAAAGAAACAGATA pLKO.1 829 CDS 100% 4.950 2.970 N FGFR1 n/a
33 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 4183 3UTR 100% 4.950 2.475 Y ERAP2 n/a
34 TRCN0000023295 CCTGGAGCATCATAATGGATT pLKO.1 1051 CDS 100% 4.950 2.970 N Fgfr1 n/a
35 TRCN0000321966 CCTGGAGCATCATAATGGATT pLKO_005 1051 CDS 100% 4.950 2.970 N Fgfr1 n/a
36 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4184 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001174067.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14638 pDONR223 0% 96.1% 96.1% None 1_99del n/a
2 ccsbBroad304_14638 pLX_304 0% 96.1% 96.1% V5 1_99del n/a
3 TRCN0000488713 AAGAGGCTTCCCATAGTAATAAAT pLX_317 14.1% 95.6% 95.6% V5 (not translated due to prior stop codon) 1_99del;540_541insCGTATG;1372_1377delGTAACA n/a
4 TRCN0000487850 TTTCTCTGAGTTGCTCGTATCGCG pLX_317 20.3% 47.9% 47.9% V5 (not translated due to prior stop codon) 1_1326del;1372_1377delGTAACA n/a
Download CSV