Transcript: Human NM_001184968.2

Homo sapiens melanocyte inducing transcription factor (MITF), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
MITF (4286)
Length:
1106
CDS:
132..407

Additional Resources:

NCBI RefSeq record:
NM_001184968.2
NBCI Gene record:
MITF (4286)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001184968.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095285 GCAGTACCTTTCTACCACTTT pLKO.1 230 CDS 100% 4.950 2.970 N Mitf n/a
2 TRCN0000323608 GCAGTACCTTTCTACCACTTT pLKO_005 230 CDS 100% 4.950 2.970 N Mitf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001184968.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06583 pDONR223 100% 99.6% 100% None 270G>A n/a
2 ccsbBroad304_06583 pLX_304 0% 99.6% 100% V5 270G>A n/a
3 TRCN0000475375 ACCGGCGCAAAGTGGTACCTTATT pLX_317 100% 99.6% 100% V5 270G>A n/a
4 ccsbBroadEn_01017 pDONR223 100% 22% 21.5% None (many diffs) n/a
5 ccsbBroad304_01017 pLX_304 0% 22% 21.5% V5 (many diffs) n/a
6 TRCN0000469674 TTCGCAATTCTTGTCATTTGACGT pLX_317 40.3% 22% 21.5% V5 (many diffs) n/a
Download CSV