Transcript: Mouse NM_001190857.1

Mus musculus PDZ and LIM domain 5 (Pdlim5), transcript variant 9, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Pdlim5 (56376)
Length:
1995
CDS:
43..747

Additional Resources:

NCBI RefSeq record:
NM_001190857.1
NBCI Gene record:
Pdlim5 (56376)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001190857.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304756 ACGACTCAGTCTCGTTCTTTC pLKO_005 562 CDS 100% 10.800 15.120 N Pdlim5 n/a
2 TRCN0000088639 TCACGTCTTTAGTCCCAAATA pLKO.1 669 CDS 100% 13.200 10.560 N Pdlim5 n/a
3 TRCN0000304702 ACCTAAGCAGCTAGCACATAC pLKO_005 767 3UTR 100% 10.800 7.560 N Pdlim5 n/a
4 TRCN0000088642 AGGGTGACATTAAGCAGCAAA pLKO.1 401 CDS 100% 4.950 3.465 N Pdlim5 n/a
5 TRCN0000088640 CTTCACGTCTTTAGTCCCAAA pLKO.1 667 CDS 100% 4.050 2.835 N Pdlim5 n/a
6 TRCN0000088638 CCCAGAACAAGATTAAGGCTT pLKO.1 239 CDS 100% 2.640 1.848 N Pdlim5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001190857.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07649 pDONR223 100% 81.1% 83.3% None (many diffs) n/a
2 ccsbBroad304_07649 pLX_304 0% 81.1% 83.3% V5 (many diffs) n/a
3 TRCN0000475444 CAAGGGATGGAAGCCACCAATCTA pLX_317 57.8% 81.1% 83.3% V5 (many diffs) n/a
4 ccsbBroadEn_07648 pDONR223 100% 32.8% 30.7% None (many diffs) n/a
5 ccsbBroad304_07648 pLX_304 0% 32.8% 30.7% V5 (many diffs) n/a
6 TRCN0000480419 AGTGTAATCATCCGAGAGCCTTTT pLX_317 24.1% 32.8% 30.7% V5 (many diffs) n/a
Download CSV