Transcript: Human NM_001207004.2

Homo sapiens UDP glucuronosyltransferase family 2 member B28 (UGT2B28), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
UGT2B28 (54490)
Length:
1549
CDS:
27..1034

Additional Resources:

NCBI RefSeq record:
NM_001207004.2
NBCI Gene record:
UGT2B28 (54490)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001207004.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424885 ACCAGATAGATGGGTTGACAT pLKO_005 1335 3UTR 100% 4.950 6.930 N UGT2B28 n/a
2 TRCN0000034730 GCATTCACTCTTAAACTCGAA pLKO.1 231 CDS 100% 2.640 3.696 N UGT2B28 n/a
3 TRCN0000034733 GTGGGAATTTCATGACATATT pLKO.1 374 CDS 100% 13.200 9.240 N UGT2B28 n/a
4 TRCN0000034729 CGGTGAATACAGCCATTGGAT pLKO.1 116 CDS 100% 3.000 2.100 N UGT2B28 n/a
5 TRCN0000427185 CAATAATTCAACATGATCAAC pLKO_005 1055 3UTR 100% 4.950 2.970 N UGT2B28 n/a
6 TRCN0000425511 ATGTGCCACAAAGGAGCCAAA pLKO_005 1120 3UTR 100% 4.050 2.430 N UGT2B28 n/a
7 TRCN0000034731 GCGCTACTTAACATACCGTTT pLKO.1 510 CDS 100% 4.050 2.430 N UGT2B28 n/a
8 TRCN0000034732 CGAGCAGTCTTCTGGATTGAA pLKO.1 1093 3UTR 100% 5.625 2.813 Y UGT2B28 n/a
9 TRCN0000036206 CTGGTTCCAGTACCACTCTTT pLKO.1 1170 3UTR 100% 4.950 2.475 Y UGT2B7 n/a
10 TRCN0000036246 CCTCATCCATTCTTACCAAAT pLKO.1 825 CDS 100% 10.800 5.400 Y UGT2B10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001207004.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01752 pDONR223 100% 59.1% 54.8% None (many diffs) n/a
2 ccsbBroad304_01752 pLX_304 0% 59.1% 54.8% V5 (many diffs) n/a
3 ccsbBroadEn_02514 pDONR223 100% 61.3% 59.9% None (many diffs) n/a
4 ccsbBroad304_02514 pLX_304 0% 61.3% 59.9% V5 (many diffs) n/a
5 ccsbBroadEn_13979 pDONR223 100% 56.8% 51.2% None (many diffs) n/a
6 ccsbBroad304_13979 pLX_304 0% 56.8% 51.2% V5 (not translated due to frame shift) (many diffs) n/a
7 TRCN0000480649 GTATCCTGATATGCGTTGCTGGGC pLX_317 26.8% 56.8% 51.2% V5 (not translated due to frame shift) (many diffs) n/a
8 ccsbBroadEn_10448 pDONR223 100% 55.4% 50.9% None (many diffs) n/a
9 ccsbBroad304_10448 pLX_304 0% 55.4% 50.9% V5 (not translated due to frame shift) (many diffs) n/a
10 TRCN0000471029 ATGCGTCAATATGTCCGATAACAC pLX_317 30.6% 55.4% 50.9% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV