Transcript: Mouse NM_001252200.1

Mus musculus mitogen-activated protein kinase kinase kinase kinase 4 (Map4k4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Map4k4 (26921)
Length:
5782
CDS:
318..4184

Additional Resources:

NCBI RefSeq record:
NM_001252200.1
NBCI Gene record:
Map4k4 (26921)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252200.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025207 CGTACTATGGTGCTTTCATTA pLKO.1 568 CDS 100% 13.200 18.480 N Map4k4 n/a
2 TRCN0000322214 CGTACTATGGTGCTTTCATTA pLKO_005 568 CDS 100% 13.200 18.480 N Map4k4 n/a
3 TRCN0000322217 GCCGACATCTGTAGCATATAT pLKO_005 3947 CDS 100% 15.000 12.000 N Map4k4 n/a
4 TRCN0000025205 GCACCTATGGACAAGTCTATA pLKO.1 418 CDS 100% 13.200 10.560 N Map4k4 n/a
5 TRCN0000322213 GCACCTATGGACAAGTCTATA pLKO_005 418 CDS 100% 13.200 10.560 N Map4k4 n/a
6 TRCN0000322216 AGAAGCAGAGAACAGATTTAA pLKO_005 4658 3UTR 100% 15.000 10.500 N Map4k4 n/a
7 TRCN0000219681 CACCTATGGACAAGTCTATAA pLKO.1 419 CDS 100% 13.200 9.240 N MAP4K4 n/a
8 TRCN0000025204 CCTGACGATAAGAAAGAAGTA pLKO.1 2634 CDS 100% 4.950 3.465 N Map4k4 n/a
9 TRCN0000322226 CCTGACGATAAGAAAGAAGTA pLKO_005 2634 CDS 100% 4.950 3.465 N Map4k4 n/a
10 TRCN0000025208 GCCTAAATGTCCTGGTGACAA pLKO.1 3388 CDS 100% 4.950 3.465 N Map4k4 n/a
11 TRCN0000025206 GCCTTTAAGTCATTTGGAGAA pLKO.1 3642 CDS 100% 4.050 2.835 N Map4k4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252200.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14940 pDONR223 22.5% 80.3% 17.8% None (many diffs) n/a
2 ccsbBroad304_14940 pLX_304 0% 80.3% 17.8% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000469592 CGGCACGATTGGGGAAGCGATCCT pLX_317 10.3% 80.3% 17.8% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000487793 TGGAGTGGCTTACGTAAATCTGCC pLX_317 7.3% 77.6% 81.9% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489356 CACTGAGATTGGACCATACTAGGT pLX_317 8.1% 77.5% 81.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV