Transcript: Mouse NM_001253738.1

Mus musculus tropomyosin 3, gamma (Tpm3), transcript variant Tpm3.1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tpm3 (59069)
Length:
2256
CDS:
212..958

Additional Resources:

NCBI RefSeq record:
NM_001253738.1
NBCI Gene record:
Tpm3 (59069)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001253738.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108794 TGCTGAAAGATCGGTAGCCAA pLKO.1 826 CDS 100% 2.640 3.696 N Tpm3 n/a
2 TRCN0000108791 GCTCGTAAGTTGGTGATTATT pLKO.1 599 CDS 100% 15.000 12.000 N Tpm3 n/a
3 TRCN0000108790 CCACTGATTTAGCCACATGAA pLKO.1 1792 3UTR 100% 4.950 3.465 N Tpm3 n/a
4 TRCN0000425801 CGTTGCCGAGAGATGGATGAA pLKO_005 668 CDS 100% 4.950 3.465 N Tpm3 n/a
5 TRCN0000108793 GCTGGACCTGAACGAGATGTA pLKO.1 937 CDS 100% 4.950 3.465 N Tpm3 n/a
6 TRCN0000162786 CAGAACCTGAAGTGTCTGAGT pLKO.1 707 CDS 100% 2.640 1.848 N TPM3P9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001253738.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15614 pDONR223 0% 93.2% 99.5% None (many diffs) n/a
2 ccsbBroad304_15614 pLX_304 0% 93.2% 99.5% V5 (many diffs) n/a
3 TRCN0000474312 TCGGGCATGCTATAACTGGACCTG pLX_317 60.2% 93.1% 98.3% V5 (not translated due to frame shift) (many diffs) n/a
4 ccsbBroadEn_11198 pDONR223 100% 49.7% 49.5% None (many diffs) n/a
5 ccsbBroad304_11198 pLX_304 0% 49.7% 49.5% V5 (many diffs) n/a
6 TRCN0000473724 CAACCCTTACTTATGAATACCCCC pLX_317 86% 49.7% 49.5% V5 (many diffs) n/a
7 ccsbBroadEn_13244 pDONR223 100% 34% 35% None (many diffs) n/a
8 ccsbBroad304_13244 pLX_304 0% 34% 35% V5 (many diffs) n/a
9 TRCN0000467014 TTGCCATGATGAACCCCCTTACCA pLX_317 100% 34% 35% V5 (many diffs) n/a
Download CSV