Transcript: Human NM_001270406.2

Homo sapiens apolipoprotein B mRNA editing enzyme catalytic subunit 3A (APOBEC3A), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
APOBEC3A (200315)
Length:
1304
CDS:
84..629

Additional Resources:

NCBI RefSeq record:
NM_001270406.2
NBCI Gene record:
APOBEC3A (200315)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001270406.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414515 GCAGTATGCTCCCGATCAAGT pLKO_005 755 3UTR 100% 4.950 6.930 N APOBEC3A n/a
2 TRCN0000418313 AGACGCCAGCAAAGCAGTATG pLKO_005 742 3UTR 100% 10.800 7.560 N APOBEC3A n/a
3 TRCN0000430628 CAGTACCAGACTCCATCTCAA pLKO_005 1059 3UTR 100% 4.950 3.465 N APOBEC3A n/a
4 TRCN0000419754 CAATGGCACCTCGGTCAAGAT pLKO_005 152 CDS 100% 4.950 2.475 Y APOBEC3A n/a
5 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 817 3UTR 100% 4.950 2.475 Y ERAP2 n/a
6 TRCN0000139812 CCTGGTTCCTTCTTTGCAGTT pLKO.1 260 CDS 100% 4.050 2.025 Y APOBEC3B n/a
7 TRCN0000049961 ACGATGAATTTAAGCACTGCT pLKO.1 493 CDS 100% 2.640 1.320 Y APOBEC3A n/a
8 TRCN0000140051 CCAAGTCTCCATCATGACCTA pLKO.1 473 CDS 100% 2.640 1.320 Y APOBEC3B n/a
9 TRCN0000049958 GCTTTCTACACAACCAGGCTA pLKO.1 187 CDS 100% 2.640 1.320 Y APOBEC3A n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 818 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001270406.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05186 pDONR223 100% 90.9% 90.9% None 27_28ins54 n/a
2 ccsbBroad304_05186 pLX_304 0% 90.9% 90.9% V5 27_28ins54 n/a
3 ccsbBroadEn_11391 pDONR223 100% 26.5% 25.6% None (many diffs) n/a
4 ccsbBroad304_11391 pLX_304 0% 26.5% 25.6% V5 (many diffs) n/a
5 TRCN0000473426 GTTAGAAGAAACTTATTTCCATTA pLX_317 28.8% 26.5% 25.6% V5 (many diffs) n/a
Download CSV