Transcript: Human NM_001270407.1

Homo sapiens junctional adhesion molecule 2 (JAM2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
JAM2 (58494)
Length:
4249
CDS:
541..1329

Additional Resources:

NCBI RefSeq record:
NM_001270407.1
NBCI Gene record:
JAM2 (58494)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001270407.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435912 ACCGTTGTTACACAAGTTATT pLKO_005 1359 3UTR 100% 13.200 18.480 N JAM2 n/a
2 TRCN0000425979 ACTCTGCTTTGTCCGACATTT pLKO_005 1393 3UTR 100% 13.200 9.240 N JAM2 n/a
3 TRCN0000422911 TCATCTAAAGCCACGACAATG pLKO_005 1267 CDS 100% 10.800 7.560 N JAM2 n/a
4 TRCN0000057847 GCTCAGAGGAAAGGCTACTTT pLKO.1 1213 CDS 100% 5.625 3.938 N JAM2 n/a
5 TRCN0000057845 GCTCATACACAATGAATACAA pLKO.1 995 CDS 100% 5.625 3.938 N JAM2 n/a
6 TRCN0000057843 GCTCCTGAATACACATGGTTT pLKO.1 919 CDS 100% 4.950 3.465 N JAM2 n/a
7 TRCN0000057844 GCTGAGATGATAGATTTCAAT pLKO.1 691 CDS 100% 5.625 3.375 N JAM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001270407.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03863 pDONR223 100% 87.9% 87.9% None 129_130ins108 n/a
2 ccsbBroad304_03863 pLX_304 0% 87.9% 87.9% V5 129_130ins108 n/a
3 TRCN0000492227 TCGTCATTTCGGGTGCGGCCTGCA pLX_317 49% 87.9% 87.9% V5 129_130ins108 n/a
Download CSV