Transcript: Human NM_001278404.2

Homo sapiens leukocyte immunoglobulin like receptor B2 (LILRB2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
LILRB2 (10288)
Length:
2789
CDS:
464..1912

Additional Resources:

NCBI RefSeq record:
NM_001278404.2
NBCI Gene record:
LILRB2 (10288)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278404.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416926 TGACGTTGGCTTTCGTATAAG pLKO_005 2282 3UTR 100% 13.200 18.480 N LILRB2 n/a
2 TRCN0000416153 GAAGTAAGAATGTGCTTTAAA pLKO_005 2160 3UTR 100% 15.000 10.500 N LILRB2 n/a
3 TRCN0000057034 CCACTCCGTCTAAGATCAATA pLKO.1 1208 CDS 100% 13.200 9.240 N LILRB2 n/a
4 TRCN0000057036 GCGATATGGCTGTCAGTATTA pLKO.1 397 5UTR 100% 13.200 9.240 N LILRB2 n/a
5 TRCN0000057033 GCATCTTGGATTACACGGATA pLKO.1 314 5UTR 100% 4.050 2.835 N LILRB2 n/a
6 TRCN0000057035 TGGCGGCTTCATTCTGTGTAA pLKO.1 565 CDS 100% 4.950 2.970 N LILRB2 n/a
7 TRCN0000057037 CGGCAGTTCCACACTTTCCTT pLKO.1 1160 CDS 100% 3.000 1.800 N LILRB2 n/a
8 TRCN0000056874 GAGAAGATGAACACCCACAAT pLKO.1 591 CDS 100% 4.950 2.475 Y LILRA1 n/a
9 TRCN0000056876 CCACACTTTCCTTCTGACCAA pLKO.1 1168 CDS 100% 2.640 1.320 Y LILRA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278404.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07695 pDONR223 100% 67.8% 63.7% None (many diffs) n/a
2 ccsbBroad304_07695 pLX_304 0% 67.8% 63.7% V5 (many diffs) n/a
3 TRCN0000477615 ACCTCCGGAGCACCCTCCTCATAA pLX_317 20.9% 67.8% 63.7% V5 (many diffs) n/a
4 ccsbBroadEn_11582 pDONR223 100% 60.1% 53.2% None (many diffs) n/a
5 ccsbBroad304_11582 pLX_304 0% 60.1% 53.2% V5 (many diffs) n/a
6 TRCN0000476797 GACTTACTCCCCGGATCTCGTAGG pLX_317 13.1% 60.1% 53.2% V5 (many diffs) n/a
7 ccsbBroadEn_02599 pDONR223 100% 55% 47.5% None (many diffs) n/a
8 ccsbBroad304_02599 pLX_304 0% 55% 47.5% V5 (many diffs) n/a
9 TRCN0000476912 AATATTGCGCGCAACCGAGCATCT pLX_317 19.2% 55% 47.5% V5 (many diffs) n/a
10 ccsbBroadEn_07730 pDONR223 100% 52.1% 44.3% None (many diffs) n/a
11 ccsbBroad304_07730 pLX_304 0% 52.1% 44.3% V5 (many diffs) n/a
12 ccsbBroadEn_07729 pDONR223 100% 48.1% 43.2% None (many diffs) n/a
13 ccsbBroad304_07729 pLX_304 0% 48.1% 43.2% V5 (many diffs) n/a
14 TRCN0000478306 AGCCAAGCTCAGGCTTTGGACACT pLX_317 25.7% 48.1% 43.2% V5 (many diffs) n/a
Download CSV