Transcript: Human NM_001282874.2

Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 (SMARCA1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
SMARCA1 (6594)
Length:
3989
CDS:
121..3333

Additional Resources:

NCBI RefSeq record:
NM_001282874.2
NBCI Gene record:
SMARCA1 (6594)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282874.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303644 ACGCAGTGGATGCCTACTTTA pLKO_005 2390 CDS 100% 13.200 18.480 N SMARCA1 n/a
2 TRCN0000050624 GCTCAAATTGAACGTGGAGAA pLKO.1 2869 CDS 100% 4.050 5.670 N SMARCA1 n/a
3 TRCN0000299418 GCTCAAATTGAACGTGGAGAA pLKO_005 2869 CDS 100% 4.050 5.670 N SMARCA1 n/a
4 TRCN0000050623 CCGAGCAAAGAGATTTGAATT pLKO.1 390 CDS 100% 0.000 0.000 N SMARCA1 n/a
5 TRCN0000380610 TGACTCGCTTGCTGGATATTT pLKO_005 1652 CDS 100% 15.000 10.500 N SMARCA1 n/a
6 TRCN0000232333 GCATACTGTGATTAGCATAAT pLKO_005 3797 3UTR 100% 13.200 9.240 N Smarca1 n/a
7 TRCN0000303643 GTGTATTCATGGTACTCTAAG pLKO_005 3409 3UTR 100% 10.800 7.560 N SMARCA1 n/a
8 TRCN0000050625 GCTCACAGAATAAAGAATGAA pLKO.1 1057 CDS 100% 5.625 3.938 N SMARCA1 n/a
9 TRCN0000299496 GCTCACAGAATAAAGAATGAA pLKO_005 1057 CDS 100% 5.625 3.938 N SMARCA1 n/a
10 TRCN0000084383 GCTTTGAAAGAGAACCTAGAT pLKO.1 3637 3UTR 100% 4.950 3.465 N Smarca1 n/a
11 TRCN0000050627 GCTGTAACACTCTGATTTCAT pLKO.1 3164 CDS 100% 5.625 3.375 N SMARCA1 n/a
12 TRCN0000299419 GCTGTAACACTCTGATTTCAT pLKO_005 3164 CDS 100% 5.625 3.375 N SMARCA1 n/a
13 TRCN0000050626 CCGCATGAAGAAAGAGAGGAT pLKO.1 1729 CDS 100% 2.640 1.584 N SMARCA1 n/a
14 TRCN0000084387 GCCTACTTTAGAGAGGCTTTA pLKO.1 2401 CDS 100% 10.800 7.560 N Smarca1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282874.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.