Transcript: Mouse NM_001283062.1

Mus musculus Ewing sarcoma breakpoint region 1 (Ewsr1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Ewsr1 (14030)
Length:
2317
CDS:
68..1924

Additional Resources:

NCBI RefSeq record:
NM_001283062.1
NBCI Gene record:
Ewsr1 (14030)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001283062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366871 GGCGACAACATTATGATTATT pLKO_005 2009 3UTR 100% 15.000 21.000 N Ewsr1 n/a
2 TRCN0000272806 GACAGCCTCCCACTGGTTATA pLKO_005 279 CDS 100% 13.200 18.480 N EWSR1 n/a
3 TRCN0000366874 GACAGCCTCCCACTGGTTATA pLKO_005 279 CDS 100% 13.200 18.480 N Ewsr1 n/a
4 TRCN0000102387 GCTCCAAGTCAATATAGCCAA pLKO.1 815 CDS 100% 2.640 3.696 N Ewsr1 n/a
5 TRCN0000102388 GATCCATATCTACCTGGATAA pLKO.1 1144 CDS 100% 1.080 1.512 N Ewsr1 n/a
6 TRCN0000379347 GCATTGACGACCAGATTTATT pLKO_005 1939 3UTR 100% 15.000 10.500 N Ewsr1 n/a
7 TRCN0000329671 CCCAGTAGCATGGGTGTTTAT pLKO_005 881 CDS 100% 13.200 9.240 N EWSR1 n/a
8 TRCN0000375799 CCCAGTAGCATGGGTGTTTAT pLKO_005 881 CDS 100% 13.200 9.240 N Ewsr1 n/a
9 TRCN0000102386 GCAATTTATGTGCAAGGATTA pLKO.1 1037 CDS 100% 10.800 7.560 N Ewsr1 n/a
10 TRCN0000366872 GCCTACTGATGTCAGCTATAC pLKO_005 205 CDS 100% 10.800 7.560 N Ewsr1 n/a
11 TRCN0000342411 TACGGGCAGCAGAGTTCATTC pLKO_005 848 CDS 100% 10.800 7.560 N EWSR1 n/a
12 TRCN0000366805 TGGACAACCCATGATCCATAT pLKO_005 1132 CDS 100% 10.800 7.560 N Ewsr1 n/a
13 TRCN0000000035 CAACAAAGCTATGGAACCTAT pLKO.1 179 CDS 100% 4.950 3.465 N EWSR1 n/a
14 TRCN0000102389 CAGCCTACTGATGTCAGCTAT pLKO.1 203 CDS 100% 4.950 3.465 N Ewsr1 n/a
15 TRCN0000000037 CAAGTCAATATAGCCAACAGA pLKO.1 819 CDS 100% 3.000 2.100 N EWSR1 n/a
16 TRCN0000000038 GCAACAAAGCTATGGAACCTA pLKO.1 178 CDS 100% 3.000 2.100 N EWSR1 n/a
17 TRCN0000272742 ATGATCTGGCAGACTTCTTTA pLKO_005 1077 CDS 100% 13.200 7.920 N EWSR1 n/a
18 TRCN0000375872 ATGATCTGGCAGACTTCTTTA pLKO_005 1077 CDS 100% 13.200 7.920 N Ewsr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001283062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15412 pDONR223 0% 88% 92.6% None (many diffs) n/a
2 ccsbBroad304_15412 pLX_304 0% 88% 92.6% V5 (many diffs) n/a
3 TRCN0000480501 CGAAGCACATCCAGTGACGGAGTC pLX_317 21.9% 88% 92.6% V5 (many diffs) n/a
4 ccsbBroadEn_15413 pDONR223 0% 87.9% 92.6% None (many diffs) n/a
5 ccsbBroad304_15413 pLX_304 0% 87.9% 92.6% V5 (many diffs) n/a
6 ccsbBroadEn_06183 pDONR223 100% 51.7% 48.8% None (many diffs) n/a
7 ccsbBroad304_06183 pLX_304 0% 51.7% 48.8% V5 (many diffs) n/a
8 TRCN0000466288 AAGTCCGCGGCTTAGCAAAGCCGG pLX_317 39.5% 51.7% 48.8% V5 (many diffs) n/a
Download CSV