Construct: ORF TRCN0000480501
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011272.1_s317c1
- Derived from:
- ccsbBroadEn_15412
- DNA Barcode:
- CGAAGCACATCCAGTGACGGAGTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- EWSR1 (2130)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480501
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | NM_001163285.2 | 99.9% | 100% | 480G>A |
| 2 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | NM_005243.4 | 99.7% | 99.8% | 480G>A;974_976delGCA |
| 3 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_011529998.2 | 99.7% | 99.8% | 100_102delCAG;483G>A |
| 4 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_011529997.2 | 99.6% | 99.6% | 100_102delCAG;483G>A;977_979delGCA |
| 5 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | NM_013986.4 | 99% | 99% | 226_243del;498G>A |
| 6 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_017028644.2 | 98% | 98% | 480G>A;1578_1616del |
| 7 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_005261389.4 | 97.8% | 97.9% | 480G>A;974_976delGCA;1581_1619del |
| 8 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_011529996.3 | 97.8% | 97.9% | 100_102delCAG;483G>A;1581_1619del |
| 9 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_011529995.3 | 97.7% | 97.7% | (many diffs) |
| 10 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_017028648.2 | 97.3% | 97.4% | 480G>A;1624_1625ins51 |
| 11 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_011530000.2 | 97% | 97.1% | (many diffs) |
| 12 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_017028647.2 | 95.4% | 95.5% | 480G>A;1578_1616del;1663_1664ins51 |
| 13 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_017028645.2 | 95.3% | 95.3% | (many diffs) |
| 14 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_017028646.2 | 95.3% | 95.3% | (many diffs) |
| 15 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_011529999.3 | 95.1% | 95.2% | (many diffs) |
| 16 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_017028653.2 | 93.6% | 93.7% | 480G>A;1290_1291ins123 |
| 17 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_017028651.2 | 93.5% | 93.5% | 480G>A;974_976delGCA;1293_1294ins123 |
| 18 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_017028652.2 | 93.5% | 93.5% | 100_102delCAG;483G>A;1293_1294ins123 |
| 19 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_017028650.2 | 93.4% | 93.4% | (many diffs) |
| 20 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_017028649.2 | 91.5% | 91.6% | (many diffs) |
| 21 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_017028659.1 | 91.4% | 91.4% | 411_412ins168 |
| 22 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | NM_001163286.2 | 91.3% | 91.3% | 411_412ins168;806_808delGCA |
| 23 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_017028658.1 | 91.3% | 91.3% | 100_102delCAG;414_415ins168 |
| 24 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_017028660.2 | 91% | 91.1% | 480G>A;1290_1291ins123;1501_1502ins51 |
| 25 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_017028655.1 | 89.6% | 89.6% | 411_412ins168;1410_1448del |
| 26 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_005261390.4 | 89.5% | 89.5% | 411_412ins168;806_808delGCA;1413_1451del |
| 27 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_017028654.1 | 89.5% | 89.5% | 100_102delCAG;414_415ins168;1413_1451del |
| 28 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_011530001.2 | 89.4% | 89.4% | (many diffs) |
| 29 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_017028661.2 | 89.2% | 88.7% | (many diffs) |
| 30 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_017028656.2 | 89.1% | 89.2% | (many diffs) |
| 31 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_017028662.2 | 88.8% | 88.8% | 411_412ins168;1456_1457ins51 |
| 32 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_017028657.2 | 87.3% | 86.8% | (many diffs) |
| 33 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_011530002.3 | 87% | 86.9% | (many diffs) |
| 34 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_024452181.1 | 86.3% | 86.2% | 480G>A;793_794ins216;1408_1409ins51 |
| 35 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_017028663.1 | 85.1% | 85.1% | 411_412ins168;1122_1123ins123 |
| 36 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_024452180.1 | 84.5% | 84.4% | (many diffs) |
| 37 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | NM_001163287.2 | 52.3% | 48% | (many diffs) |
| 38 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XR_002958676.1 | 50% | (many diffs) | |
| 39 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_017028665.2 | 48.3% | 48.3% | 0_1ins1014 |
| 40 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_017028666.2 | 48.3% | 48.3% | 0_1ins1014 |
| 41 | human | 2130 | EWSR1 | EWS RNA binding protein 1 | XM_017028664.2 | 47.4% | 47.4% | 0_1ins1014;564_602del |
| 42 | mouse | 14030 | Ewsr1 | Ewing sarcoma breakpoint re... | NM_007968.3 | 93.4% | 97.8% | (many diffs) |
| 43 | mouse | 14030 | Ewsr1 | Ewing sarcoma breakpoint re... | NM_001283061.1 | 93.3% | 97.7% | (many diffs) |
| 44 | mouse | 14030 | Ewsr1 | Ewing sarcoma breakpoint re... | XM_006514512.3 | 92.6% | 96.9% | (many diffs) |
| 45 | mouse | 14030 | Ewsr1 | Ewing sarcoma breakpoint re... | XM_017314255.1 | 92.6% | 96.9% | (many diffs) |
| 46 | mouse | 14030 | Ewsr1 | Ewing sarcoma breakpoint re... | XM_006514510.2 | 92.4% | 96.8% | (many diffs) |
| 47 | mouse | 14030 | Ewsr1 | Ewing sarcoma breakpoint re... | XM_006514511.2 | 92.4% | 96.8% | (many diffs) |
| 48 | mouse | 14030 | Ewsr1 | Ewing sarcoma breakpoint re... | XM_006514509.2 | 91.8% | 96.1% | (many diffs) |
| 49 | mouse | 14030 | Ewsr1 | Ewing sarcoma breakpoint re... | XM_006514508.2 | 91.6% | 95.9% | (many diffs) |
| 50 | mouse | 14030 | Ewsr1 | Ewing sarcoma breakpoint re... | NM_001283062.1 | 88% | 92.6% | (many diffs) |
| 51 | mouse | 14030 | Ewsr1 | Ewing sarcoma breakpoint re... | XR_001779874.1 | 73.8% | (many diffs) | |
| 52 | mouse | 14030 | Ewsr1 | Ewing sarcoma breakpoint re... | NM_001283063.1 | 46.7% | 48% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2031
- ORF length:
- 1965
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gtccacggat tacagtacct atagccaagc tgcagcgcag cagggctaca 121 gtgcttacac cgcccagccc actcaaggat atgcacagac cacccaggca tatgggcaac 181 aaagctatgg aacctatgga cagcccactg atgtcagcta tacccaggct cagaccactg 241 caacctatgg gcagaccgcc tatgcaactt cttatggaca gcctcccact ggttatacta 301 ctccaactgc cccccaggca tacagccagc ctgtccaggg gtatggcact ggtgcttatg 361 ataccaccac tgctacagtc accaccaccc aggcctccta tgcagctcag tctgcatatg 421 gcactcagcc tgcttatcca gcctatgggc agcagccagc agccactgca cctacaagac 481 cgcaggatgg aaacaagccc actgagacta gtcaacctca atctagcaca gggggttaca 541 accaacccag cctaggatat ggacagagta actacagtta tccccaggta cctgggagct 601 accccatgca gccagtcact gcacctccat cctaccctcc taccagctat tcctctacac 661 agccgactag ttatgatcag agcagttact ctcagcagaa cacctatggg caaccgagca 721 gctatggaca gcagagtagc tatggtcaac aaagcagcta tgggcagcag cctcccacta 781 gttacccacc ccaaactgga tcctacagcc aagctccaag tcaatatagc caacagagca 841 gcagctacgg gcagcagagt tcattccgac aggaccaccc cagtagcatg ggtgtttatg 901 ggcaggagtc tggaggattt tccggaccag gagagaaccg gagcatgagt ggccctgata 961 accggggcag gggaagaggg ggatttgatc gtggaggcat gagcagaggt gggcggggag 1021 gaggacgcgg tggaatgggc gctggagagc gaggtggctt caataagcct ggtggaccca 1081 tggatgaagg accagatctt gatctaggcc cacctgtaga tccagatgaa gactctgaca 1141 acagtgcaat ttatgtacaa ggattaaatg acagtgtgac tctagatgat ctggcagact 1201 tctttaagca gtgtggggtt gttaagatga acaagagaac tgggcaaccc atgatccaca 1261 tctacctgga caaggaaaca ggaaagccca aaggcgatgc cacagtgtcc tatgaagacc 1321 cacccactgc caaggctgcc gtggaatggt ttgatgggaa agattttcaa gggagcaaac 1381 ttaaagtctc ccttgctcgg aagaagcctc caatgaacag tatgcggggt ggtctgccac 1441 cccgtgaggg cagaggcatg ccaccaccac tccgtggagg tccaggaggc ccaggaggtc 1501 ctgggggacc catgggtcgc atgggaggcc gtggaggaga tagaggaggc ttccctccaa 1561 gaggaccccg gggttcccga gggaacccct ctggaggagg aaacgtCCAG CACCGAGCTG 1621 GAGACTGGCA GTGTCCCAAT CCGGGTTGTG GAAACCAGAA CTTCGCCTGG AGAACAGAGT 1681 GCAACCAGTG TAAGGCCCCA AAGCCTGAAG GCTTCCTCCC GCCACCCTTT CCGCCCCCGG 1741 GTGGTGATCG TGGCAGAGGT GGCCCTGGTG GCATGCGGGG AGGAAGAGGT GGCCTCATGG 1801 ATCGTGGTGG TCCCGGTGGA ATGTTCAGAG GTGGCCGTGG TGGAGACAGA GGTGGCTTCC 1861 GTGGTGGCCG GGGCATGGAC CGAGGTGGCT TTGGTGGAGG AAGACGAGGT GGCCCTGGGG 1921 GGCCCCCTGG ACCTTTGATG GAACAGATGG GAGGAAGAAG AGGAGGACGT GGAGGACCTG 1981 GAAAAATGGA TAAAGGCGAG CACCGTCAGG AGCGCAGAGA TCGGCCCTAC TACCCAACTT 2041 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 2101 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 2161 CTTGTGGAAA GGACGACGAA GCACATCCAG TGACGGAGTC ACGCGTTAAG TCgacaatca 2221 acctctggat tacaaaattt gtgaaagatt