Transcript: Human NM_001286503.1

Homo sapiens heat shock protein family H (Hsp110) member 1 (HSPH1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
HSPH1 (10808)
Length:
5228
CDS:
440..2884

Additional Resources:

NCBI RefSeq record:
NM_001286503.1
NBCI Gene record:
HSPH1 (10808)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286503.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159636 GACTCTACATAACATACTGAA pLKO.1 2941 3UTR 100% 4.950 6.930 N HSPH1 n/a
2 TRCN0000275691 TGCTTTGAATTACGGAATTTA pLKO_005 970 CDS 100% 15.000 12.000 N HSPH1 n/a
3 TRCN0000161810 CAAGACTAAGTCTGACTTCAT pLKO.1 3302 3UTR 100% 4.950 3.960 N HSPH1 n/a
4 TRCN0000162700 CCACTGAATATCGAATGCTTT pLKO.1 1292 CDS 100% 4.950 3.960 N HSPH1 n/a
5 TRCN0000216419 GACCTTCTTAACATGTATATT pLKO.1 2132 CDS 100% 15.000 10.500 N Hsph1 n/a
6 TRCN0000275688 ATGAGAAATACAACCATATTG pLKO_005 2517 CDS 100% 13.200 9.240 N HSPH1 n/a
7 TRCN0000160320 CCATATTGATGAGTCTGAAAT pLKO.1 2530 CDS 100% 13.200 9.240 N HSPH1 n/a
8 TRCN0000160594 CCAGTAACAGATTGTGTTATT pLKO.1 845 CDS 100% 1.320 0.924 N HSPH1 n/a
9 TRCN0000275617 CCAGTAACAGATTGTGTTATT pLKO_005 845 CDS 100% 1.320 0.924 N HSPH1 n/a
10 TRCN0000275689 AGCTTAAGTCTGTAGTCTTTA pLKO_005 3027 3UTR 100% 13.200 7.920 N HSPH1 n/a
11 TRCN0000166087 GCTGCCTATTGAAGCCAACTT pLKO.1 2092 CDS 100% 4.950 2.970 N HSPH1 n/a
12 TRCN0000275690 GCTGCCTATTGAAGCCAACTT pLKO_005 2092 CDS 100% 4.950 2.970 N HSPH1 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4268 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4268 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286503.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02531 pDONR223 100% 94.8% 94.8% None 1584_1585ins132 n/a
2 ccsbBroad304_02531 pLX_304 0% 94.8% 94.8% V5 1584_1585ins132 n/a
3 TRCN0000473053 GTCCATGCTTTTCGTCAACATACG pLX_317 5.3% 94.8% 94.8% V5 1584_1585ins132 n/a
Download CSV