Transcript: Human NM_001300842.3

Homo sapiens solute carrier family 10 member 7 (SLC10A7), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
SLC10A7 (84068)
Length:
3867
CDS:
224..1300

Additional Resources:

NCBI RefSeq record:
NM_001300842.3
NBCI Gene record:
SLC10A7 (84068)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001300842.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152464 CCTCTCATCATTGGACAGATT pLKO.1 761 CDS 100% 4.950 6.930 N SLC10A7 n/a
2 TRCN0000154194 CCACGTATAGAACTACGAGAA pLKO.1 2633 3UTR 100% 4.050 5.670 N SLC10A7 n/a
3 TRCN0000153300 GCCAACAATCAAGTCTTGGAT pLKO.1 1180 CDS 100% 3.000 2.400 N SLC10A7 n/a
4 TRCN0000147553 GAGGCAGCTGCAATATTTAAT pLKO.1 617 CDS 100% 15.000 10.500 N SLC10A7 n/a
5 TRCN0000149893 GAAATGAGGCAGCTGCAATAT pLKO.1 612 CDS 100% 13.200 9.240 N SLC10A7 n/a
6 TRCN0000154292 GCCATGAGCATCTCTCTTTAA pLKO.1 1101 CDS 100% 13.200 9.240 N SLC10A7 n/a
7 TRCN0000152650 GCCTGTTACATCCTGGAATTA pLKO.1 2296 3UTR 100% 13.200 9.240 N SLC10A7 n/a
8 TRCN0000157440 GACTGGTTCATGGTCGGAATA pLKO.1 251 CDS 100% 10.800 7.560 N SLC10A7 n/a
9 TRCN0000180984 CCAGTGCTTTGGTGCATCTAA pLKO.1 414 CDS 100% 5.625 3.938 N SLC10A7 n/a
10 TRCN0000157543 GCAGACACAGTGGCTATCATT pLKO.1 1019 CDS 100% 5.625 3.938 N SLC10A7 n/a
11 TRCN0000150111 CTGAAGCCAGAAATAACTGTA pLKO.1 329 CDS 100% 4.950 3.465 N SLC10A7 n/a
12 TRCN0000149358 GACCACTGAAGCCAGAAATAA pLKO.1 324 CDS 100% 15.000 9.000 N SLC10A7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300842.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12773 pDONR223 100% 51.9% 51.6% None 556_562delATTGTCC;566_1074del n/a
2 ccsbBroad304_12773 pLX_304 0% 51.9% 51.6% V5 556_562delATTGTCC;566_1074del n/a
3 TRCN0000471611 CAGCATACGTATGAGAGAGACTTT pLX_317 72.9% 51.9% 51.6% V5 556_562delATTGTCC;566_1074del n/a
4 ccsbBroadEn_16026 pDONR223 0% 42.6% 41.6% None (many diffs) n/a
5 ccsbBroad304_16026 pLX_304 0% 42.6% 41.6% V5 (many diffs) n/a
6 ccsbBroadEn_12772 pDONR223 100% 17.4% 17.5% None 184_186delGAGinsCTT;189G>T;192_1074delinsT n/a
7 ccsbBroad304_12772 pLX_304 0% 17.4% 17.5% V5 184_186delGAGinsCTT;189G>T;192_1074delinsT n/a
8 TRCN0000481615 TGCCGATCACAAAGCTGGCGATTC pLX_317 100% 17.4% 17.5% V5 184_186delGAGinsCTT;189G>T;192_1074delinsT n/a
Download CSV