Transcript: Human NM_001302946.2

Homo sapiens tRNA nucleotidyl transferase 1 (TRNT1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
TRNT1 (51095)
Length:
2192
CDS:
79..1323

Additional Resources:

NCBI RefSeq record:
NM_001302946.2
NBCI Gene record:
TRNT1 (51095)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001302946.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035752 CGCAGAGATCTCACTATAAAT pLKO.1 526 CDS 100% 15.000 21.000 N TRNT1 n/a
2 TRCN0000035751 CCCTATCAAGACTTCATTATA pLKO.1 1051 CDS 100% 15.000 10.500 N TRNT1 n/a
3 TRCN0000035749 GCCTCATTATTCAAAGTACAA pLKO.1 907 CDS 100% 4.950 3.465 N TRNT1 n/a
4 TRCN0000035750 CCCTACTCAAATGAAGGAGAT pLKO.1 333 CDS 100% 4.050 2.835 N TRNT1 n/a
5 TRCN0000035753 CCATTCCTCCATTTCCTGTAA pLKO.1 1163 CDS 100% 4.950 2.970 N TRNT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001302946.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11949 pDONR223 100% 88.6% 88.7% None 1_87del;741_742ins60;888A>G n/a
2 ccsbBroad304_11949 pLX_304 0% 88.6% 88.7% V5 1_87del;741_742ins60;888A>G n/a
3 TRCN0000473813 CGTTCAGAAAACATGCATAGCTCT pLX_317 40.9% 88.6% 88.7% V5 1_87del;741_742ins60;888A>G n/a
4 ccsbBroadEn_11948 pDONR223 100% 12.8% 12% None (many diffs) n/a
5 ccsbBroad304_11948 pLX_304 0% 12.8% 12% V5 (many diffs) n/a
6 TRCN0000473260 TCGGATCCGGCAGAAAGACGTTCT pLX_317 100% 12.8% 12% V5 (many diffs) n/a
Download CSV