Transcript: Human NM_001330450.2

Homo sapiens mitogen-activated protein kinase kinase 6 (MAP2K6), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
MAP2K6 (5608)
Length:
13525
CDS:
577..1413

Additional Resources:

NCBI RefSeq record:
NM_001330450.2
NBCI Gene record:
MAP2K6 (5608)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330450.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196746 GCTACGGTAGTGATGAAATTA pLKO.1 1745 3UTR 100% 15.000 21.000 N MAP2K6 n/a
2 TRCN0000320696 GGCCTTGGAATCTATAGTATA pLKO_005 1575 3UTR 100% 13.200 18.480 N MAP2K6 n/a
3 TRCN0000382304 GAGTTGGCCATCCTTCGATTT pLKO_005 1153 CDS 100% 10.800 15.120 N MAP2K6 n/a
4 TRCN0000009987 GGCCTACATACCCAGAGCTAA pLKO.1 1313 CDS 100% 4.950 6.930 N MAP2K6 n/a
5 TRCN0000009990 CGGCTACTGATGGATTTGGAT pLKO.1 691 CDS 100% 3.000 4.200 N MAP2K6 n/a
6 TRCN0000380833 GGATCCGAGCCACAGTAAATA pLKO_005 656 CDS 100% 15.000 12.000 N MAP2K6 n/a
7 TRCN0000320792 ACTGATGGATTTGGATATTTC pLKO_005 696 CDS 100% 13.200 10.560 N MAP2K6 n/a
8 TRCN0000320697 GATGACCTGGAGCCTATAATG pLKO_005 559 5UTR 100% 13.200 10.560 N MAP2K6 n/a
9 TRCN0000320770 GAGCTAATGCAACATCCATTT pLKO_005 1327 CDS 100% 10.800 8.640 N MAP2K6 n/a
10 TRCN0000009989 CCGAGCCACAGTAAATAGCCA pLKO.1 660 CDS 100% 0.750 0.600 N MAP2K6 n/a
11 TRCN0000009991 CAATGCTCTCGGTCAAGTGAA pLKO.1 969 CDS 100% 4.950 3.465 N MAP2K6 n/a
12 TRCN0000350353 CAATGCTCTCGGTCAAGTGAA pLKO_005 969 CDS 100% 4.950 3.465 N MAP2K6 n/a
13 TRCN0000009988 CCTATAATGGAACTGGGACGA pLKO.1 571 5UTR 100% 2.160 1.512 N MAP2K6 n/a
14 TRCN0000195654 CTCCATTTCAGCAGCTCAAAC pLKO.1 1193 CDS 100% 10.800 6.480 N MAP2K6 n/a
15 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 5418 3UTR 100% 4.950 2.475 Y ERAP2 n/a
16 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5419 3UTR 100% 13.200 6.600 Y LIAS n/a
17 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 5583 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330450.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01291 pDONR223 100% 83.2% 83.2% None 0_1ins168 n/a
2 ccsbBroad304_01291 pLX_304 0% 83.2% 83.2% V5 0_1ins168 n/a
3 TRCN0000472398 TATATCCATGATGTCTATAAATAT pLX_317 37.8% 83.2% 83.2% V5 0_1ins168 n/a
4 ccsbBroadEn_14810 pDONR223 0% 83.2% 83.2% None 0_1ins168 n/a
5 ccsbBroad304_14810 pLX_304 0% 83.2% 83.2% V5 0_1ins168 n/a
6 TRCN0000467778 GAACAGTGCGAGCGACACCTGAGA pLX_317 34.2% 83.2% 83.2% V5 0_1ins168 n/a
7 TRCN0000492175 CACTGTTGATGCCTACAGTTGAGT pLX_317 34.2% 82.9% 82.9% V5 (not translated due to prior stop codon) 0_1ins168;834_835insTTG n/a
Download CSV