Transcript: Human NM_001346579.1

Homo sapiens zinc finger with KRAB and SCAN domains 1 (ZKSCAN1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-21
Taxon:
Homo sapiens (human)
Gene:
ZKSCAN1 (7586)
Length:
1653
CDS:
264..1229

Additional Resources:

NCBI RefSeq record:
NM_001346579.1
NBCI Gene record:
ZKSCAN1 (7586)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001346579.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018136 CTGCACTATTCACAGCGGATT pLKO.1 910 CDS 100% 4.050 5.670 N ZKSCAN1 n/a
2 TRCN0000018134 CCAGAAATAAACACCAAGGAA pLKO.1 522 CDS 100% 3.000 2.100 N ZKSCAN1 n/a
3 TRCN0000018137 CGCTTCTGTTACCAGAACACT pLKO.1 444 CDS 100% 0.300 0.210 N ZKSCAN1 n/a
4 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1565 3UTR 100% 13.200 6.600 Y LIAS n/a
5 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1564 3UTR 100% 4.950 2.475 Y ERAP2 n/a
6 TRCN0000143232 GAAGAGGAAGATGAGGAAGAA pLKO.1 348 CDS 100% 4.950 2.475 Y ARMH4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346579.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01799 pDONR223 100% 51.5% 43.8% None (many diffs) n/a
2 ccsbBroad304_01799 pLX_304 0% 51.5% 43.8% V5 (many diffs) n/a
3 TRCN0000468174 GGCTGATACACAGACCGACTATGA pLX_317 20.7% 51.5% 43.8% V5 (many diffs) n/a
4 ccsbBroadEn_15622 pDONR223 0% 51.5% 43.7% None (many diffs) n/a
5 ccsbBroad304_15622 pLX_304 0% 51.5% 43.7% V5 (many diffs) n/a
6 TRCN0000467809 CCACCCTGTTAGCTGCGGCCAGAG pLX_317 23.6% 51.5% 43.7% V5 (many diffs) n/a
Download CSV