Transcript: Mouse NM_001347534.1

Mus musculus heat shock 105kDa/110kDa protein 1 (Hsph1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-04-24
Taxon:
Mus musculus (mouse)
Gene:
Hsph1 (15505)
Length:
3367
CDS:
261..2705

Additional Resources:

NCBI RefSeq record:
NM_001347534.1
NBCI Gene record:
Hsph1 (15505)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347534.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217088 CAATTCTTTCTCCGGCATTTA pLKO.1 1402 CDS 100% 13.200 18.480 N Hsph1 n/a
2 TRCN0000179891 CCATAGTATGTGATCCTGTAT pLKO.1 2748 3UTR 100% 4.950 6.930 N Hsph1 n/a
3 TRCN0000180505 GCAGGCATACATTGACAAGTT pLKO.1 2186 CDS 100% 4.950 3.960 N Hsph1 n/a
4 TRCN0000180724 GCCATAGTATGTGATCCTGTA pLKO.1 2747 3UTR 100% 4.050 3.240 N Hsph1 n/a
5 TRCN0000336031 GCCATAGTATGTGATCCTGTA pLKO_005 2747 3UTR 100% 4.050 3.240 N Hsph1 n/a
6 TRCN0000216419 GACCTTCTTAACATGTATATT pLKO.1 1956 CDS 100% 15.000 10.500 N Hsph1 n/a
7 TRCN0000353418 CCATGCTGCTGACTAAGTTAA pLKO_005 616 CDS 100% 13.200 9.240 N Hsph1 n/a
8 TRCN0000217533 CGGCTGTTGCTTTGAATTATG pLKO.1 784 CDS 100% 13.200 9.240 N Hsph1 n/a
9 TRCN0000179858 CGAGTGCTTTATGAATGACAA pLKO.1 1124 CDS 100% 4.950 3.465 N Hsph1 n/a
10 TRCN0000335969 CGAGTGCTTTATGAATGACAA pLKO_005 1124 CDS 100% 4.950 3.465 N Hsph1 n/a
11 TRCN0000180617 GAGATTTCATGGCAGAGCATT pLKO.1 464 CDS 100% 4.950 3.465 N Hsph1 n/a
12 TRCN0000184271 GCCAACTTGGTATGGCAGTTA pLKO.1 1929 CDS 100% 4.950 3.465 N Hsph1 n/a
13 TRCN0000181087 CCTGTTGTAACTCAACCCAAA pLKO.1 2523 CDS 100% 4.050 2.430 N Hsph1 n/a
14 TRCN0000335970 CCTGTTGTAACTCAACCCAAA pLKO_005 2523 CDS 100% 4.050 2.430 N Hsph1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347534.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02531 pDONR223 100% 81.5% 88.7% None (many diffs) n/a
2 ccsbBroad304_02531 pLX_304 0% 81.5% 88.7% V5 (many diffs) n/a
3 TRCN0000473053 GTCCATGCTTTTCGTCAACATACG pLX_317 5.3% 81.5% 88.7% V5 (many diffs) n/a
Download CSV