Transcript: Human NM_001347828.2

Homo sapiens platelet derived growth factor receptor alpha (PDGFRA), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
PDGFRA (5156)
Length:
6456
CDS:
139..3483

Additional Resources:

NCBI RefSeq record:
NM_001347828.2
NBCI Gene record:
PDGFRA (5156)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001347828.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426196 GCACACGGAGCTATGTTATTT pLKO_005 2360 CDS 100% 15.000 21.000 N PDGFRA n/a
2 TRCN0000419988 CCTCTAGGAATGACGGATTAT pLKO_005 601 CDS 100% 13.200 18.480 N PDGFRA n/a
3 TRCN0000196928 GCTAGCAATTGCGACCTTAAT pLKO.1 5063 3UTR 100% 13.200 18.480 N PDGFRA n/a
4 TRCN0000420441 ATGGAGATTTGGTCAACTATT pLKO_005 2249 CDS 100% 13.200 9.240 N PDGFRA n/a
5 TRCN0000428845 CTTCACTGTAGGGCCCTATAT pLKO_005 756 CDS 100% 13.200 9.240 N PDGFRA n/a
6 TRCN0000195423 CCAAAGAAAGAGCTGGATATC pLKO.1 2314 CDS 100% 10.800 7.560 N PDGFRA n/a
7 TRCN0000196272 GCTTAATTGCTGATACCATAT pLKO.1 5419 3UTR 100% 10.800 7.560 N PDGFRA n/a
8 TRCN0000001423 CCAGCCTCATATAAGAAGAAA pLKO.1 2506 CDS 100% 5.625 3.938 N PDGFRA n/a
9 TRCN0000001424 CCAGCTTTCATTACCCTCTAT pLKO.1 282 CDS 100% 4.950 3.465 N PDGFRA n/a
10 TRCN0000001422 CCCAACTTTCTTATCCAACTT pLKO.1 5558 3UTR 100% 4.950 3.465 N PDGFRA n/a
11 TRCN0000001425 CGGTGAAAGACAGTGGAGATT pLKO.1 1055 CDS 100% 4.950 3.465 N PDGFRA n/a
12 TRCN0000001426 CAATGGACTTACCCTGGAGAA pLKO.1 949 CDS 100% 4.050 2.835 N PDGFRA n/a
13 TRCN0000199733 GCCGTGTGACTTTCGCCAAAG pLKO.1 1670 CDS 100% 2.000 1.400 N PDGFRA n/a
14 TRCN0000195132 CTACTACTGTTATCAGTAATG pLKO.1 4145 3UTR 100% 1.080 0.756 N PDGFRA n/a
15 TRCN0000194855 CCCTCTGAAATAATGGGATTA pLKO.1 4428 3UTR 100% 10.800 6.480 N PDGFRA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347828.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14734 pDONR223 0% 97.7% 97.7% None 1_75del;3297T>C n/a
2 ccsbBroad304_14734 pLX_304 0% 97.7% 97.7% V5 1_75del;3297T>C n/a
3 TRCN0000472927 CCCTCGTGGCCGGGGGTTCCCTGT pLX_317 13.3% 97.6% 97.7% V5 1_75del;3297T>C;3341_3342delTG n/a
4 TRCN0000491475 TCTACTAACGTTGCATTAGTGGAT pLX_317 10.3% 97.6% 97.7% V5 (not translated due to prior stop codon) 1_75del;1776A>G;3297T>C n/a
5 TRCN0000489486 AGACCGCATTTGGTGACAGGGCCA pLX_317 20.7% 46.7% .5% V5 (not translated due to prior stop codon) 1_1777del;3297T>C n/a
6 ccsbBroadEn_11024 pDONR223 100% 19.1% 18.8% None (many diffs) n/a
7 ccsbBroad304_11024 pLX_304 0% 19.1% 18.8% V5 (many diffs) n/a
8 TRCN0000468062 GAATTGTACCGACACCTAGAGGAC pLX_317 58.6% 19.1% 18.8% V5 (many diffs) n/a
Download CSV