Transcript: Human NM_001347829.2

Homo sapiens platelet derived growth factor receptor alpha (PDGFRA), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
PDGFRA (5156)
Length:
6599
CDS:
357..3626

Additional Resources:

NCBI RefSeq record:
NM_001347829.2
NBCI Gene record:
PDGFRA (5156)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001347829.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426196 GCACACGGAGCTATGTTATTT pLKO_005 2503 CDS 100% 15.000 21.000 N PDGFRA n/a
2 TRCN0000419988 CCTCTAGGAATGACGGATTAT pLKO_005 744 CDS 100% 13.200 18.480 N PDGFRA n/a
3 TRCN0000196928 GCTAGCAATTGCGACCTTAAT pLKO.1 5206 3UTR 100% 13.200 18.480 N PDGFRA n/a
4 TRCN0000420441 ATGGAGATTTGGTCAACTATT pLKO_005 2392 CDS 100% 13.200 9.240 N PDGFRA n/a
5 TRCN0000428845 CTTCACTGTAGGGCCCTATAT pLKO_005 899 CDS 100% 13.200 9.240 N PDGFRA n/a
6 TRCN0000195423 CCAAAGAAAGAGCTGGATATC pLKO.1 2457 CDS 100% 10.800 7.560 N PDGFRA n/a
7 TRCN0000196272 GCTTAATTGCTGATACCATAT pLKO.1 5562 3UTR 100% 10.800 7.560 N PDGFRA n/a
8 TRCN0000001423 CCAGCCTCATATAAGAAGAAA pLKO.1 2649 CDS 100% 5.625 3.938 N PDGFRA n/a
9 TRCN0000001424 CCAGCTTTCATTACCCTCTAT pLKO.1 425 CDS 100% 4.950 3.465 N PDGFRA n/a
10 TRCN0000001422 CCCAACTTTCTTATCCAACTT pLKO.1 5701 3UTR 100% 4.950 3.465 N PDGFRA n/a
11 TRCN0000001425 CGGTGAAAGACAGTGGAGATT pLKO.1 1198 CDS 100% 4.950 3.465 N PDGFRA n/a
12 TRCN0000001426 CAATGGACTTACCCTGGAGAA pLKO.1 1092 CDS 100% 4.050 2.835 N PDGFRA n/a
13 TRCN0000199733 GCCGTGTGACTTTCGCCAAAG pLKO.1 1813 CDS 100% 2.000 1.400 N PDGFRA n/a
14 TRCN0000195132 CTACTACTGTTATCAGTAATG pLKO.1 4288 3UTR 100% 1.080 0.756 N PDGFRA n/a
15 TRCN0000194855 CCCTCTGAAATAATGGGATTA pLKO.1 4571 3UTR 100% 10.800 6.480 N PDGFRA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347829.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14734 pDONR223 0% 99.9% 100% None 3222T>C n/a
2 ccsbBroad304_14734 pLX_304 0% 99.9% 100% V5 3222T>C n/a
3 TRCN0000472927 CCCTCGTGGCCGGGGGTTCCCTGT pLX_317 13.3% 99.9% 100% V5 3222T>C;3266_3267delTG n/a
4 TRCN0000491475 TCTACTAACGTTGCATTAGTGGAT pLX_317 10.3% 99.9% 100% V5 (not translated due to prior stop codon) 1701A>G;3222T>C n/a
5 TRCN0000489486 AGACCGCATTTGGTGACAGGGCCA pLX_317 20.7% 47.8% .5% V5 (not translated due to prior stop codon) 1_1702del;3222T>C n/a
6 ccsbBroadEn_11024 pDONR223 100% 19.5% 19.2% None (many diffs) n/a
7 ccsbBroad304_11024 pLX_304 0% 19.5% 19.2% V5 (many diffs) n/a
8 TRCN0000468062 GAATTGTACCGACACCTAGAGGAC pLX_317 58.6% 19.5% 19.2% V5 (many diffs) n/a
Download CSV