Transcript: Human NM_001349654.1

Homo sapiens ribosomal protein S6 kinase C1 (RPS6KC1), transcript variant 15, mRNA.

Source:
NCBI, updated 2018-06-15
Taxon:
Homo sapiens (human)
Gene:
RPS6KC1 (26750)
Length:
5615
CDS:
911..3475

Additional Resources:

NCBI RefSeq record:
NM_001349654.1
NBCI Gene record:
RPS6KC1 (26750)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001349654.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003261 CCAAGGTGTGATCTGAATTTA pLKO.1 3696 3UTR 100% 15.000 10.500 N RPS6KC1 n/a
2 TRCN0000342652 CCAAGGTGTGATCTGAATTTA pLKO_005 3696 3UTR 100% 15.000 10.500 N RPS6KC1 n/a
3 TRCN0000194946 CAATGGGACCTACTAAGTTTA pLKO.1 2394 CDS 100% 13.200 9.240 N RPS6KC1 n/a
4 TRCN0000194662 CCTGATGCTGTATAATGTATG pLKO.1 3994 3UTR 100% 10.800 7.560 N RPS6KC1 n/a
5 TRCN0000003260 GCAATGAATATGGGCAAGAAA pLKO.1 1821 CDS 100% 5.625 3.938 N RPS6KC1 n/a
6 TRCN0000342715 GCAATGAATATGGGCAAGAAA pLKO_005 1821 CDS 100% 5.625 3.938 N RPS6KC1 n/a
7 TRCN0000003259 GCTTTACATAGAGAGGGAATT pLKO.1 3029 CDS 100% 0.000 0.000 N RPS6KC1 n/a
8 TRCN0000342716 GCTTTACATAGAGAGGGAATT pLKO_005 3029 CDS 100% 0.000 0.000 N RPS6KC1 n/a
9 TRCN0000003263 CCCAGCTCAGATCCTAAGTTT pLKO.1 2651 CDS 100% 5.625 3.375 N RPS6KC1 n/a
10 TRCN0000003262 GCTCACTCAGATTCCCTCATT pLKO.1 713 5UTR 100% 4.950 2.970 N RPS6KC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001349654.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15038 pDONR223 51.4% 79.2% 3.6% None (many diffs) n/a
2 ccsbBroad304_15038 pLX_304 0% 79.2% 3.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000474713 AATAACAGTGTAGTAGCCATAGAT pLX_317 14.2% 79.2% 3.6% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000489782 CACACTTTCGCTGCCGTTTGCCTC pLX_317 27.9% 54.9% 54.9% V5 (not translated due to prior stop codon) 1_1155del n/a
Download CSV