Transcript: Human NM_001351028.2

Homo sapiens actin related protein 3C (ACTR3C), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
ACTR3C (653857)
Length:
8630
CDS:
670..1029

Additional Resources:

NCBI RefSeq record:
NM_001351028.2
NBCI Gene record:
ACTR3C (653857)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351028.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108328 GCCATCGATAAACCTACATAT pLKO.1 844 CDS 100% 13.200 6.600 Y ACTR3B n/a
2 TRCN0000418383 CGATACGACATGGAATCATTG pLKO_005 878 CDS 100% 10.800 5.400 Y ACTR3B n/a
3 TRCN0000434511 TCATTGAAGACTGGGATCTTA pLKO_005 893 CDS 100% 5.625 2.813 Y ACTR3B n/a
4 TRCN0000414318 AGTTCATTATTCCTTCATGTA pLKO_005 731 CDS 100% 4.950 2.475 Y ACTR3B n/a
5 TRCN0000423092 TAGGAGATGAAGCCATCGATA pLKO_005 833 CDS 100% 4.950 2.475 Y ACTR3B n/a
6 TRCN0000108327 CCAGGACTCTACATTGCAGTT pLKO.1 150 5UTR 100% 4.050 2.025 Y ACTR3B n/a
7 TRCN0000414906 GAGTCAGCAAAGGTAGTTGAC pLKO_005 763 CDS 100% 4.050 2.025 Y ACTR3B n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1222 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000090296 CCAGGACTCTACATTGCAGTA pLKO.1 150 5UTR 100% 4.050 2.025 Y Actr3b n/a
10 TRCN0000136945 CCATGATTCAATTACCTCCCA pLKO.1 2182 3UTR 100% 0.660 0.330 Y DISC1 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1222 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351028.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03802 pDONR223 100% 32.1% 30.7% None (many diffs) n/a
2 ccsbBroad304_03802 pLX_304 0% 32.1% 30.7% V5 (many diffs) n/a
3 TRCN0000491360 AAGTAAGAACTACCAGACTCACCT pLX_317 33.1% 32.1% 30.7% V5 (many diffs) n/a
4 ccsbBroadEn_03803 pDONR223 100% 26.7% 25.5% None (many diffs) n/a
5 ccsbBroad304_03803 pLX_304 0% 26.7% 25.5% V5 (many diffs) n/a
6 TRCN0000480353 AATTTTCGGGTCTCCGCCAGAGAG pLX_317 33.6% 26.7% 25.5% V5 (many diffs) n/a
Download CSV