Transcript: Human NM_001355017.2

Homo sapiens platelet derived growth factor receptor beta (PDGFRB), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PDGFRB (5159)
Length:
5734
CDS:
973..3810

Additional Resources:

NCBI RefSeq record:
NM_001355017.2
NBCI Gene record:
PDGFRB (5159)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001355017.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380950 ATCATGCGGGACTCGAATTAC pLKO_005 3040 CDS 100% 13.200 18.480 N PDGFRB n/a
2 TRCN0000199396 CACCATTCCATGCCGAGTAAC pLKO.1 890 5UTR 100% 10.800 15.120 N PDGFRB n/a
3 TRCN0000196262 GCAACTTTGATCAACGAGTCT pLKO.1 2854 CDS 100% 2.640 3.696 N PDGFRB n/a
4 TRCN0000001998 CCAAAGGAGGACCCATCTATA pLKO.1 2504 CDS 100% 13.200 9.240 N PDGFRB n/a
5 TRCN0000001997 GCTCACCATCATCTCCCTTAT pLKO.1 2118 CDS 100% 10.800 7.560 N PDGFRB n/a
6 TRCN0000002000 GTGGATTCTGATGCCTACTAT pLKO.1 1050 CDS 100% 5.625 3.938 N PDGFRB n/a
7 TRCN0000002001 GACTCGAATTACATCTCCAAA pLKO.1 3049 CDS 100% 4.950 3.465 N PDGFRB n/a
8 TRCN0000001999 CCCTCAGTCTTAATCCATCCA pLKO.1 4567 3UTR 100% 2.640 1.848 N PDGFRB n/a
9 TRCN0000199859 GCTGGAACAGTTGCCGGATTC pLKO.1 3744 CDS 100% 2.000 1.400 N PDGFRB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001355017.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14736 pDONR223 0% 83.5% 81.8% None 0_1ins517;114_147del n/a
2 ccsbBroad304_14736 pLX_304 0% 83.5% 81.8% V5 0_1ins517;114_147del n/a
3 TRCN0000469110 GACGGTGGAGGGATTATCAGACCA pLX_317 10% 83.5% 81.8% V5 0_1ins517;114_147del;2834_2835delTG n/a
4 ccsbBroadEn_06708 pDONR223 100% 83.5% 81.8% None 0_1ins517;22C>T;114_147del n/a
5 ccsbBroad304_06708 pLX_304 0% 83.5% 81.8% V5 0_1ins517;22C>T;114_147del n/a
6 TRCN0000478789 ATCATTCATAGAGTAAGACTGTAC pLX_317 9.9% 83.5% 81.8% V5 0_1ins517;22C>T;114_147del n/a
7 TRCN0000487742 ACACCCGCTTGAGCTACACACACC pLX_317 4.7% 83.5% 81.8% V5 (not translated due to prior stop codon) 0_1ins517;22C>T;114_147del n/a
8 TRCN0000489549 GAATTTGTTGTAATTGCGTTAAAC pLX_317 18.3% 56% 1.4% V5 (not translated due to prior stop codon) 1_1246del n/a
Download CSV