Transcript: Human NM_001355240.1

Homo sapiens zinc finger protein 738 (ZNF738), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-06-15
Taxon:
Homo sapiens (human)
Gene:
ZNF738 (148203)
Length:
1222
CDS:
212..565

Additional Resources:

NCBI RefSeq record:
NM_001355240.1
NBCI Gene record:
ZNF738 (148203)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001355240.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018501 GCCGTTGACATTTAGGGATGT pLKO.1 310 CDS 100% 4.050 2.025 Y ZNF493 n/a
2 TRCN0000017702 CCCTGGAATATGAAGAGACAT pLKO.1 488 CDS 100% 4.950 2.475 Y ZNF430 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001355240.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10299 pDONR223 100% 82.6% 79.5% None (many diffs) n/a
2 ccsbBroad304_10299 pLX_304 0% 82.6% 79.5% V5 (many diffs) n/a
3 TRCN0000470427 ATGCTGATTAAATGGTCGTCTGCC pLX_317 95.5% 82.6% 79.5% V5 (many diffs) n/a
4 ccsbBroadEn_15729 pDONR223 0% 59.9% 52.1% None (many diffs) n/a
5 ccsbBroad304_15729 pLX_304 0% 59.9% 52.1% V5 (many diffs) n/a
6 TRCN0000470492 GCCGACTTGCTCCATGATGCAGCT pLX_317 100% 59.9% 52.1% V5 (many diffs) n/a
7 TRCN0000472761 GCGGTTCAATGTTGTAGTCTTGTG pLX_317 63.8% 39.3% 33.3% V5 (not translated due to frame shift) (many diffs) n/a
8 ccsbBroadEn_15273 pDONR223 50.9% 19.1% 16.2% None (many diffs) n/a
9 ccsbBroad304_15273 pLX_304 0% 19.1% 16.2% V5 (many diffs) n/a
10 ccsbBroadEn_15167 pDONR223 53.6% 17.9% 31% None (many diffs) n/a
11 ccsbBroad304_15167 pLX_304 0% 17.9% 31% V5 (not translated due to prior stop codon) (many diffs) n/a
12 ccsbBroadEn_13028 pDONR223 100% 8.1% 6.7% None (many diffs) n/a
13 ccsbBroad304_13028 pLX_304 0% 8.1% 6.7% V5 (many diffs) n/a
14 TRCN0000468257 GTACACCAGACCACTACATGCGAC pLX_317 25.6% 8.1% 6.7% V5 (many diffs) n/a
Download CSV