Transcript: Human NM_001363791.1

Homo sapiens STE20 related adaptor alpha (STRADA), transcript variant 12, mRNA.

Source:
NCBI, updated 2018-11-23
Taxon:
Homo sapiens (human)
Gene:
STRADA (92335)
Length:
2233
CDS:
436..1293

Additional Resources:

NCBI RefSeq record:
NM_001363791.1
NBCI Gene record:
STRADA (92335)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145789 GATATGGCACGATATTGGGA pXPR_003 TGG 209 24% 6 1.0888 STRADA STRADA 76053
2 BRDN0001148926 ACCTGTGTACATATCCCATG pXPR_003 TGG 392 46% 7 0.8284 STRADA STRADA 76054
3 BRDN0001149192 CAGACTTGGCATCATAACCC pXPR_003 TGG 590 69% 9 0.7493 STRADA STRADA 76056
4 BRDN0001145392 GAGAGTACGTGACTGTACGG pXPR_003 AGG 123 14% 5 0.4596 STRADA STRADA 76055
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363791.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000284824 TGAATCTAGCAAGGTACAAAC pLKO_005 515 CDS 100% 10.800 15.120 N STRADA n/a
2 TRCN0000007049 CGTGACTGTACGGAGGATTAA pLKO.1 549 CDS 100% 13.200 10.560 N STRADA n/a
3 TRCN0000284822 CGTGACTGTACGGAGGATTAA pLKO_005 549 CDS 100% 13.200 10.560 N STRADA n/a
4 TRCN0000007048 CCATCCCAATATCGTGCCATA pLKO.1 639 CDS 100% 4.050 3.240 N STRADA n/a
5 TRCN0000272728 CCATCCCAATATCGTGCCATA pLKO_005 639 CDS 100% 4.050 3.240 N STRADA n/a
6 TRCN0000272738 TCAATAGCATCCTTCTCTAAA pLKO_005 406 5UTR 100% 13.200 9.240 N STRADA n/a
7 TRCN0000195518 CAGCAACCTCAGCATGATAAG pLKO.1 906 CDS 100% 10.800 7.560 N STRADA n/a
8 TRCN0000007047 GCTGACTGATTGGGAAAGAAA pLKO.1 1599 3UTR 100% 5.625 3.938 N STRADA n/a
9 TRCN0000284826 GCTGACTGATTGGGAAAGAAA pLKO_005 1599 3UTR 100% 5.625 3.938 N STRADA n/a
10 TRCN0000197062 GCTGTGGGTTGTCACATCATT pLKO.1 687 CDS 100% 5.625 3.938 N STRADA n/a
11 TRCN0000007051 CACTGTGATAGGCAAAGGATT pLKO.1 477 CDS 100% 4.950 3.465 N STRADA n/a
12 TRCN0000195667 CAAGTACAGTGTCAAGGTTCT pLKO.1 963 CDS 100% 4.050 2.835 N STRADA n/a
13 TRCN0000200013 CCTGTTGGATACCAGCACCAT pLKO.1 1155 CDS 100% 2.640 1.848 N STRADA n/a
14 TRCN0000007050 CAGCAGAATCTCCAGGGTTAT pLKO.1 1009 CDS 100% 10.800 6.480 N STRADA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363791.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12979 pDONR223 100% 80.6% 79.2% None (many diffs) n/a
2 ccsbBroad304_12979 pLX_304 0% 80.6% 79.2% V5 (many diffs) n/a
3 TRCN0000471765 ATCATTTCTTACTGCGCAAGTCCT pLX_317 64.4% 80.6% 79.2% V5 (many diffs) n/a
4 ccsbBroadEn_15217 pDONR223 0% 80.6% 79.2% None (many diffs) n/a
5 ccsbBroad304_15217 pLX_304 0% 80.6% 79.2% V5 (many diffs) n/a
6 TRCN0000481363 CTTCCTGGCGGTTGGATTAAAATA pLX_317 70.2% 80.6% 79.2% V5 (many diffs) n/a
7 TRCN0000487854 GAATGTCTAGGATGTCATATAACA pLX_317 21.7% 70.8% 69.6% V5 (not translated due to prior stop codon) 0_1ins87;834_835ins91;855_856ins173 n/a
8 TRCN0000488716 GGTCGCGAGCCGTTCCGTTTAGGT pLX_317 17.8% 46.2% 72.7% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000491266 TCCCTCTTGAAAGCGGACAAACCA pLX_317 13.9% 46.1% 72.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV