Transcript: Human NM_001370181.1

Homo sapiens glutathione S-transferase C-terminal domain containing (GSTCD), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-07
Taxon:
Homo sapiens (human)
Gene:
GSTCD (79807)
Length:
4304
CDS:
255..2156

Additional Resources:

NCBI RefSeq record:
NM_001370181.1
NBCI Gene record:
GSTCD (79807)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370181.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218785 GATACTCCGTTCAAGTGATAT pLKO_005 2077 CDS 100% 13.200 18.480 N GSTCD n/a
2 TRCN0000158776 GCTGTTGTATTGAGACACATA pLKO.1 570 CDS 100% 4.950 6.930 N GSTCD n/a
3 TRCN0000162277 CTCAACTGAACAGCATCCAAA pLKO.1 1298 CDS 100% 4.950 3.960 N GSTCD n/a
4 TRCN0000230799 TGATCATCACTATGGATTAAA pLKO_005 3831 3UTR 100% 15.000 10.500 N GSTCD n/a
5 TRCN0000230798 CCATCATGTCAGGTTACATTA pLKO_005 1644 CDS 100% 13.200 9.240 N GSTCD n/a
6 TRCN0000230796 CTTGCCCTGTATCCATCATTT pLKO_005 1124 CDS 100% 13.200 9.240 N GSTCD n/a
7 TRCN0000159953 GTTATCTTACTGTGACTGTAA pLKO.1 365 CDS 100% 4.950 3.465 N GSTCD n/a
8 TRCN0000160951 GTGGTAACAAATCAGGCCAAA pLKO.1 1554 CDS 100% 4.050 2.835 N GSTCD n/a
9 TRCN0000166574 CCTCAACTGAACAGCATCCAA pLKO.1 1297 CDS 100% 3.000 2.100 N GSTCD n/a
10 TRCN0000160607 CCTGTAGAAATACTACAGCTA pLKO.1 771 CDS 100% 0.264 0.185 N GSTCD n/a
11 TRCN0000230797 ACCAACCATGGCCAAGTTAAT pLKO_005 1379 CDS 100% 13.200 7.920 N GSTCD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370181.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12622 pDONR223 100% 99.8% 99.8% None 989_991delCAG n/a
2 ccsbBroad304_12622 pLX_304 0% 99.8% 99.8% V5 989_991delCAG n/a
3 TRCN0000471538 AAGCAACTATGAACTGCCATCCGA pLX_317 24.9% 99.8% 99.8% V5 989_991delCAG n/a
Download CSV