Transcript: Human NM_002529.3

Homo sapiens neurotrophic receptor tyrosine kinase 1 (NTRK1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
NTRK1 (4914)
Length:
2663
CDS:
57..2447

Additional Resources:

NCBI RefSeq record:
NM_002529.3
NBCI Gene record:
NTRK1 (4914)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002529.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001992 TATCTACAGCACCGACTATTA pLKO.1 2078 CDS 100% 13.200 18.480 N NTRK1 n/a
2 TRCN0000001994 TGGCATGAGCAGGGATATCTA pLKO.1 2063 CDS 100% 5.625 7.875 N NTRK1 n/a
3 TRCN0000219698 AGTCAGCCACGGTGATGAAAT pLKO.1 757 CDS 100% 13.200 9.240 N NTRK1 n/a
4 TRCN0000196447 GCTCATGGTCTTTGAGTATAT pLKO.1 1811 CDS 100% 13.200 9.240 N NTRK1 n/a
5 TRCN0000219699 TGCTCCTTGTGCTCAACAAAT pLKO.1 1360 CDS 100% 13.200 9.240 N NTRK1 n/a
6 TRCN0000001995 CATCGAGAACCCACAATACTT pLKO.1 1526 CDS 100% 5.625 3.938 N NTRK1 n/a
7 TRCN0000001993 TGCCTTCATGGACAACCCTTT pLKO.1 1184 CDS 100% 4.050 2.835 N NTRK1 n/a
8 TRCN0000199815 GCTGGCCATGTCCCTGCATTT pLKO.1 1439 CDS 100% 3.600 2.520 N NTRK1 n/a
9 TRCN0000001996 TACATCGAGAACCAGCAGCAT pLKO.1 270 CDS 100% 2.640 1.848 N NTRK1 n/a
10 TRCN0000199063 CCTGCTGGCTTGGCTGATACT pLKO.1 119 CDS 100% 1.650 1.155 N NTRK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002529.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14720 pDONR223 0% 99.2% 99.2% None 1177_1194del n/a
2 ccsbBroad304_14720 pLX_304 0% 99.2% 99.2% V5 1177_1194del n/a
3 TRCN0000469111 CGAATCGAACTGAGCTTCCAGCTA pLX_317 17.5% 99.2% 99.2% V5 1177_1194del n/a
4 TRCN0000488623 CGGACCAGCGCATGACCTTCAAGA pLX_317 11% 96% 95.9% V5 (many diffs) n/a
5 TRCN0000487892 ACCACTCCCTTCGGGGGACCGTGA pLX_317 10.2% 96% 95.9% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000488699 TCGCATACTTCTTACGAACCCCTT pLX_317 33.4% 42.2% .6% V5 (not translated due to prior stop codon) 1_1378del;1674G>A n/a
Download CSV