Transcript: Human NM_002759.3

Homo sapiens eukaryotic translation initiation factor 2 alpha kinase 2 (EIF2AK2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
EIF2AK2 (5610)
Length:
4361
CDS:
558..2213

Additional Resources:

NCBI RefSeq record:
NM_002759.3
NBCI Gene record:
EIF2AK2 (5610)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002759.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001382 TCGACCTAACACATCTGAAAT pLKO.1 2132 CDS 100% 13.200 18.480 N EIF2AK2 n/a
2 TRCN0000194764 CTACAGAAATTACTCTCAAAG pLKO.1 2100 CDS 100% 10.800 7.560 N EIF2AK2 n/a
3 TRCN0000197170 GAAGGTGAAGGTAGATCAAAG pLKO.1 717 CDS 100% 10.800 7.560 N EIF2AK2 n/a
4 TRCN0000197012 GAGGCGAGAAACTAGACAAAG pLKO.1 1702 CDS 100% 10.800 7.560 N EIF2AK2 n/a
5 TRCN0000001380 GCCGCTAAACTTGCATATCTT pLKO.1 1026 CDS 100% 5.625 3.938 N EIF2AK2 n/a
6 TRCN0000001381 GCTGTTGGGATGGATTTGATT pLKO.1 1531 CDS 100% 5.625 3.938 N EIF2AK2 n/a
7 TRCN0000001383 ACTTAATACATACCGTCAGAA pLKO.1 596 CDS 100% 4.950 3.465 N EIF2AK2 n/a
8 TRCN0000196400 GCTGAACTTCTTCATGTATGT pLKO.1 1992 CDS 100% 4.950 3.465 N EIF2AK2 n/a
9 TRCN0000001379 TCCTGGCTCATCTCTTTATTC pLKO.1 2410 3UTR 100% 13.200 7.920 N EIF2AK2 n/a
10 TRCN0000199172 CCTCCTGAGTAGCTGGATTAC pLKO.1 2546 3UTR 100% 10.800 5.400 Y EIF2AK2 n/a
11 TRCN0000027026 GCAGCCAAATTAGCTGTTGAT pLKO.1 756 CDS 100% 4.950 3.465 N Eif2ak2 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2682 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2682 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002759.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01292 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01292 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481403 CTTCTGCCCGCATGAGTCTAAACG pLX_317 26% 100% 100% V5 n/a
4 TRCN0000488901 CGTAATTCACATTTTCAAATGTAG pLX_317 20.9% 100% 100% V5 (not translated due to prior stop codon) n/a
5 TRCN0000489224 GGCCTCTGCTGAAATAACCAAACC pLX_317 13.2% 99.8% 99.6% V5 303C>N;1653_1654insG n/a
6 ccsbBroadEn_14812 pDONR223 95.4% 96.3% 43.1% None (many diffs) n/a
7 ccsbBroad304_14812 pLX_304 0% 96.3% 43.1% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000468904 AGTTTCAGCGAAGGTGATAATAGA pLX_317 22.7% 96.3% 43.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV