Transcript: Human NM_003079.5

Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 (SMARCE1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
SMARCE1 (6605)
Length:
5150
CDS:
92..1327

Additional Resources:

NCBI RefSeq record:
NM_003079.5
NBCI Gene record:
SMARCE1 (6605)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003079.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015779 CCGCGTACCTTGCTTACATAA pLKO.1 501 CDS 100% 13.200 18.480 N SMARCE1 n/a
2 TRCN0000274145 CCGCGTACCTTGCTTACATAA pLKO_005 501 CDS 100% 13.200 18.480 N SMARCE1 n/a
3 TRCN0000274204 ACGTGATCATGTATGAGTATG pLKO_005 1766 3UTR 100% 10.800 15.120 N SMARCE1 n/a
4 TRCN0000015778 CCATAGTTAGAGTAGTTACTT pLKO.1 1903 3UTR 100% 5.625 7.875 N SMARCE1 n/a
5 TRCN0000233989 ATACAGTCATCTCGCCTACAA pLKO_005 181 CDS 100% 4.950 6.930 N Smarce1 n/a
6 TRCN0000233988 GGATACAATCCATACAGTCAT pLKO_005 170 CDS 100% 4.950 3.960 N Smarce1 n/a
7 TRCN0000233987 CAGGGTTTGTGGGATACAATC pLKO_005 159 CDS 100% 10.800 7.560 N Smarce1 n/a
8 TRCN0000274251 CAGGGTTTGTGGGATACAATC pLKO_005 159 CDS 100% 10.800 7.560 N SMARCE1 n/a
9 TRCN0000081944 CCAGGGTTTGTGGGATACAAT pLKO.1 158 CDS 100% 5.625 3.938 N Smarce1 n/a
10 TRCN0000015781 CGCCTCATCAGTGAAATTCTT pLKO.1 692 CDS 100% 5.625 3.938 N SMARCE1 n/a
11 TRCN0000274203 CGCCTCATCAGTGAAATTCTT pLKO_005 692 CDS 100% 5.625 3.938 N SMARCE1 n/a
12 TRCN0000015780 CCCATACCAGAAGATGAGAAA pLKO.1 1298 CDS 100% 4.950 3.465 N SMARCE1 n/a
13 TRCN0000274146 CCCATACCAGAAGATGAGAAA pLKO_005 1298 CDS 100% 4.950 3.465 N SMARCE1 n/a
14 TRCN0000015782 CTCTGGTATCACGATTCCAAA pLKO.1 253 CDS 100% 4.950 3.465 N SMARCE1 n/a
15 TRCN0000233986 CCCAGCTCCTGCAACACAAAT pLKO_005 127 CDS 100% 13.200 6.600 Y Smarce1 n/a
16 TRCN0000081946 GCATGGAGAAAGGAGAACCTT pLKO.1 579 CDS 100% 3.000 1.800 N Smarce1 n/a
17 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3480 3UTR 100% 5.625 2.813 Y KLHL30 n/a
18 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3480 3UTR 100% 5.625 2.813 Y EID2B n/a
19 TRCN0000157796 CGCATGGAGAAAGGAGAACAT pLKO.1 578 CDS 100% 4.950 2.475 Y FKBP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003079.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15596 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_15596 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478729 TCACATCCAGTTTGGAGAAAGGTC pLX_317 31.7% 100% 100% V5 n/a
4 ccsbBroadEn_06976 pDONR223 100% 99.9% 99.7% None 136G>A n/a
5 ccsbBroad304_06976 pLX_304 0% 99.9% 99.7% V5 136G>A n/a
6 TRCN0000471989 GGATACCGGTCGTCCGGTGAAGTG pLX_317 13.8% 99.9% 99.7% V5 136G>A n/a
Download CSV