Transcript: Human NM_005829.5

Homo sapiens adaptor related protein complex 3 subunit sigma 2 (AP3S2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
AP3S2 (10239)
Length:
5543
CDS:
46..627

Additional Resources:

NCBI RefSeq record:
NM_005829.5
NBCI Gene record:
AP3S2 (10239)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005829.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065216 CCAGCGTTTCCCAGAAGAAAT pLKO.1 105 CDS 100% 13.200 9.240 N AP3S2 n/a
2 TRCN0000300221 CCAGCGTTTCCCAGAAGAAAT pLKO_005 105 CDS 100% 13.200 9.240 N AP3S2 n/a
3 TRCN0000065215 GCTACCCTCTACTTTGTATTT pLKO.1 250 CDS 100% 13.200 6.600 Y AP3S2 n/a
4 TRCN0000310572 GCTACCCTCTACTTTGTATTT pLKO_005 250 CDS 100% 13.200 6.600 Y AP3S2 n/a
5 TRCN0000380049 GGAAACAAACATGAATGAAAT pLKO_005 435 CDS 100% 13.200 6.600 Y AP3S2 n/a
6 TRCN0000380681 TTCCTCGGAACATCAACATTG pLKO_005 563 CDS 100% 10.800 5.400 Y AP3S2 n/a
7 TRCN0000379501 TTCTTGGAGGGTGGAAGTTTG pLKO_005 190 CDS 100% 10.800 5.400 Y AP3S2 n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3374 3UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 1409 3UTR 100% 4.950 2.475 Y n/a
10 TRCN0000065217 GCAGATTGTTCGAGAGACTTT pLKO.1 132 CDS 100% 4.950 2.475 Y AP3S2 n/a
11 TRCN0000300222 GCAGATTGTTCGAGAGACTTT pLKO_005 132 CDS 100% 4.950 2.475 Y AP3S2 n/a
12 TRCN0000065214 GCGGGATGACAACATCTGTAA pLKO.1 168 CDS 100% 4.950 2.475 Y AP3S2 n/a
13 TRCN0000300223 GCGGGATGACAACATCTGTAA pLKO_005 168 CDS 100% 4.950 2.475 Y AP3S2 n/a
14 TRCN0000065213 CGGAACATCAACATTGGCGAT pLKO.1 568 CDS 100% 2.160 1.080 Y AP3S2 n/a
15 TRCN0000113173 CCATATGGATAAGGTGCACTA pLKO.1 378 CDS 100% 0.000 0.000 Y Ap3s2 n/a
16 TRCN0000309515 CCATATGGATAAGGTGCACTA pLKO_005 378 CDS 100% 0.000 0.000 Y Ap3s2 n/a
17 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3375 3UTR 100% 13.200 6.600 Y LIAS n/a
18 TRCN0000113171 GCTCTGACTACAAACTGATTT pLKO.1 218 CDS 100% 13.200 6.600 Y Ap3s2 n/a
19 TRCN0000309517 GCTCTGACTACAAACTGATTT pLKO_005 218 CDS 100% 13.200 6.600 Y Ap3s2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005829.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07574 pDONR223 100% 99.8% None 5T>G n/a
2 ccsbBroad304_07574 pLX_304 0% 99.8% V5 (not translated due to prior stop codon) 5T>G n/a
3 TRCN0000466505 TTATACGCAAACTTCTCCTGACGA pLX_317 73.6% 99.8% V5 (not translated due to prior stop codon) 5T>G n/a
Download CSV