Transcript: Human NM_006343.3

Homo sapiens MER proto-oncogene, tyrosine kinase (MERTK), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
MERTK (10461)
Length:
3826
CDS:
130..3129

Additional Resources:

NCBI RefSeq record:
NM_006343.3
NBCI Gene record:
MERTK (10461)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006343.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196952 GCACACGGTTGGGTAGATTAT pLKO.1 1573 CDS 100% 13.200 18.480 N MERTK n/a
2 TRCN0000196327 GCTCAATCAGTGTACCTAATA pLKO.1 473 CDS 100% 13.200 18.480 N MERTK n/a
3 TRCN0000197079 GTTCAGACAATGGGTCGTATA pLKO.1 629 CDS 100% 10.800 15.120 N MERTK n/a
4 TRCN0000000864 CGAGCCATTGAACTTACCTTA pLKO.1 1801 CDS 100% 4.950 6.930 N MERTK n/a
5 TRCN0000194841 CAGACGTTATTTACGTCAATA pLKO.1 2732 CDS 100% 1.320 1.848 N MERTK n/a
6 TRCN0000000865 CCTGCATACTTACTTACTTTA pLKO.1 2163 CDS 100% 13.200 10.560 N MERTK n/a
7 TRCN0000425278 GTAATGGCTCAGTCATGATTT pLKO_005 1112 CDS 100% 13.200 10.560 N MERTK n/a
8 TRCN0000382184 AGATTTACAGTGGCGATTATT pLKO_005 2369 CDS 100% 15.000 10.500 N MERTK n/a
9 TRCN0000000862 GCTTCTGGTCTTGATGTATTT pLKO.1 3528 3UTR 100% 13.200 9.240 N MERTK n/a
10 TRCN0000442967 AGCCAAGCCTTACCCGCTATT pLKO_005 213 CDS 100% 10.800 7.560 N MERTK n/a
11 TRCN0000000866 GAAGATTTACAGTGGCGATTA pLKO.1 2367 CDS 100% 10.800 7.560 N MERTK n/a
12 TRCN0000196404 GTATTTGTCTTCCTTACCAAG pLKO.1 3209 3UTR 100% 4.050 2.835 N MERTK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006343.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14964 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_14964 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481025 ACTTTATCTCACAGCTGTTTTGCG pLX_317 13.7% 99.9% 100% V5 2996_2997delTG n/a
4 TRCN0000491689 AGGCTTCGAATTACTGCTTCCCAA pLX_317 9.7% 100% 100% V5 (not translated due to prior stop codon) n/a
5 ccsbBroadEn_11503 pDONR223 100% 82.2% 82.1% None (many diffs) n/a
6 ccsbBroad304_11503 pLX_304 0% 82.2% 82.1% V5 (many diffs) n/a
7 TRCN0000492043 CGTGCAGAAACTAGCTGGTATTGG pLX_317 23.1% 46.2% V5 (not translated due to prior stop codon) 1_1612del n/a
Download CSV