Transcript: Human NM_006483.3

Homo sapiens dual specificity tyrosine phosphorylation regulated kinase 1B (DYRK1B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
DYRK1B (9149)
Length:
2376
CDS:
242..2011

Additional Resources:

NCBI RefSeq record:
NM_006483.3
NBCI Gene record:
DYRK1B (9149)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146749 GATGAAGTACTATATAGGTG pXPR_003 AGG 520 29% 5 1.0728 DYRK1B DYRK1B 76622
2 BRDN0001149418 AGGCTCGCAAGTACTTTGAA pXPR_003 CGG 1041 59% 8 0.555 DYRK1B DYRK1B 76621
3 BRDN0001149482 CATGACTACATCGTGCGCAG pXPR_003 TGG 305 17% 4 0.4647 DYRK1B DYRK1B 76623
4 BRDN0001149374 CACAGAGAGCTTACGCAGCG pXPR_003 GGG 133 8% 3 -0.2387 DYRK1B DYRK1B 76624
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006483.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355722 ACCGCTACAGCAACCGATATT pLKO_005 1569 CDS 100% 13.200 18.480 N DYRK1B n/a
2 TRCN0000355721 ACGAAATTGACTCGCTCATTG pLKO_005 573 CDS 100% 10.800 15.120 N DYRK1B n/a
3 TRCN0000002141 CACGGAGATGAAGTACTATAT pLKO.1 739 CDS 100% 13.200 10.560 N DYRK1B n/a
4 TRCN0000355723 ACGGAGATGAAGTACTATATA pLKO_005 740 CDS 100% 15.000 10.500 N DYRK1B n/a
5 TRCN0000435463 ACATCAATGAGGTATACTATG pLKO_005 414 CDS 100% 10.800 7.560 N Dyrk1b n/a
6 TRCN0000002139 GACCTACAAGCACATCAATGA pLKO.1 403 CDS 100% 4.950 3.465 N DYRK1B n/a
7 TRCN0000002142 TGACGACAACCATGACTACAT pLKO.1 520 CDS 100% 4.950 3.465 N DYRK1B n/a
8 TRCN0000195657 CCATGGTTATGATGACGACAA pLKO.1 508 CDS 100% 4.050 2.835 N DYRK1B n/a
9 TRCN0000002140 CCTTGACTGGAATTGCTGCTA pLKO.1 2092 3UTR 100% 2.640 1.848 N DYRK1B n/a
10 TRCN0000002143 GAAGGACGAAAGAACTCAGGA pLKO.1 1314 CDS 100% 2.640 1.848 N DYRK1B n/a
11 TRCN0000199056 CCCTCCGGACTCGGATGACTG pLKO.1 1893 CDS 100% 0.000 0.000 N DYRK1B n/a
12 TRCN0000355724 ACCACCTGTGCCTGGTATTTG pLKO_005 792 CDS 100% 13.200 7.920 N DYRK1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006483.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489760 AATATGTTGATGCCGAGACCTTCC pLX_317 16.8% 100% 100% V5 (not translated due to prior stop codon) n/a
2 ccsbBroadEn_14931 pDONR223 0% 93.6% 93.6% None 1093_1094ins120 n/a
3 ccsbBroad304_14931 pLX_304 0% 93.6% 93.6% V5 1093_1094ins120 n/a
4 TRCN0000479503 CGCACGTACGGTCGGCCCGAATGT pLX_317 16.1% 93.6% 93.6% V5 1093_1094ins120 n/a
Download CSV