Transcript: Human NM_006484.2

Homo sapiens dual specificity tyrosine phosphorylation regulated kinase 1B (DYRK1B), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
DYRK1B (9149)
Length:
2504
CDS:
313..2118

Additional Resources:

NCBI RefSeq record:
NM_006484.2
NBCI Gene record:
DYRK1B (9149)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006484.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355722 ACCGCTACAGCAACCGATATT pLKO_005 1676 CDS 100% 13.200 18.480 N DYRK1B n/a
2 TRCN0000355721 ACGAAATTGACTCGCTCATTG pLKO_005 644 CDS 100% 10.800 15.120 N DYRK1B n/a
3 TRCN0000002141 CACGGAGATGAAGTACTATAT pLKO.1 810 CDS 100% 13.200 10.560 N DYRK1B n/a
4 TRCN0000355723 ACGGAGATGAAGTACTATATA pLKO_005 811 CDS 100% 15.000 10.500 N DYRK1B n/a
5 TRCN0000435463 ACATCAATGAGGTATACTATG pLKO_005 485 CDS 100% 10.800 7.560 N Dyrk1b n/a
6 TRCN0000002139 GACCTACAAGCACATCAATGA pLKO.1 474 CDS 100% 4.950 3.465 N DYRK1B n/a
7 TRCN0000002142 TGACGACAACCATGACTACAT pLKO.1 591 CDS 100% 4.950 3.465 N DYRK1B n/a
8 TRCN0000195657 CCATGGTTATGATGACGACAA pLKO.1 579 CDS 100% 4.050 2.835 N DYRK1B n/a
9 TRCN0000002140 CCTTGACTGGAATTGCTGCTA pLKO.1 2199 3UTR 100% 2.640 1.848 N DYRK1B n/a
10 TRCN0000002143 GAAGGACGAAAGAACTCAGGA pLKO.1 1385 CDS 100% 2.640 1.848 N DYRK1B n/a
11 TRCN0000199056 CCCTCCGGACTCGGATGACTG pLKO.1 2000 CDS 100% 0.000 0.000 N DYRK1B n/a
12 TRCN0000355724 ACCACCTGTGCCTGGTATTTG pLKO_005 863 CDS 100% 13.200 7.920 N DYRK1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006484.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489760 AATATGTTGATGCCGAGACCTTCC pLX_317 16.8% 98% 98% V5 (not translated due to prior stop codon) 1094_1129del n/a
2 ccsbBroadEn_14931 pDONR223 0% 95.5% 95.5% None 1129_1130ins84 n/a
3 ccsbBroad304_14931 pLX_304 0% 95.5% 95.5% V5 1129_1130ins84 n/a
4 TRCN0000479503 CGCACGTACGGTCGGCCCGAATGT pLX_317 16.1% 95.5% 95.5% V5 1129_1130ins84 n/a
Download CSV